Sequence ID | dm3.chr2R |
---|---|
Location | 17,537,263 – 17,537,326 |
Length | 63 |
Max. P | 0.684477 |
Location | 17,537,263 – 17,537,326 |
---|---|
Length | 63 |
Sequences | 6 |
Columns | 71 |
Reading direction | reverse |
Mean pairwise identity | 69.67 |
Shannon entropy | 0.55944 |
G+C content | 0.43452 |
Mean single sequence MFE | -14.97 |
Consensus MFE | -6.29 |
Energy contribution | -6.33 |
Covariance contribution | 0.05 |
Combinations/Pair | 1.50 |
Mean z-score | -1.55 |
Structure conservation index | 0.42 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 0.41 |
SVM RNA-class probability | 0.684477 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 17537263 63 - 21146708 CUGAUGACGACACAUUAAGUGGCUGGC--GGGGACGACUAUUCCAUAG------UUCUUGAGUGUAAUCAG (((((....((((.(((((.(((((..--.((((......)))).)))------))))))))))).))))) ( -18.70, z-score = -2.06, R) >droEre2.scaffold_4845 11686386 63 - 22589142 CUGAUGACGACACAUUAAGUGGCGGGC--GGGGACAACUAUUUUAUAG------UUCUUGGGUGUAAUCAG (((((....((((.(((((........--(....)((((((...))))------))))))))))).))))) ( -13.70, z-score = -1.20, R) >droYak2.chr2R 9504359 69 + 21139217 UUGAUGACGACACAUUAAGUGGCGGGC--GGGGACAACUAUUUCAUUGAUUACACUCAAGAAUGUAAUCAA ..(((((((.(((.....))).))...--(....).......)))))(((((((........))))))).. ( -14.90, z-score = -2.12, R) >droSec1.super_9 863227 63 - 3197100 CUGAUGACGACACAUUAAGUGGCGGGC--GGGGACGACUAUUCCAUAG------UUCUUGAGUGUAAUCAG (((((....((((.((((((((..(((--(....)).))...)))...------..))))))))).))))) ( -18.20, z-score = -1.88, R) >droSim1.chr2R 16186466 63 - 19596830 CUGAUGACGACACAUUAAGUGGCGGGC--GGGGACGACUAUUCCAUAG------UUCUUGAGUGUAAUCAG (((((....((((.((((((((..(((--(....)).))...)))...------..))))))))).))))) ( -18.20, z-score = -1.88, R) >droGri2.scaffold_15112 2321571 57 + 5172618 --------GAUUGUUUAUGUGUGUGCCUUGAAAAUUGUUAUUACGUAAUUGAUAUUGAUAAUUGC------ --------.(((..(((((((...((..(....)..))...)))))))..)))............------ ( -6.10, z-score = -0.18, R) >consensus CUGAUGACGACACAUUAAGUGGCGGGC__GGGGACGACUAUUCCAUAG______UUCUUGAGUGUAAUCAG (((((....((((.(((((...........((((......))))............))))))))).))))) ( -6.29 = -6.33 + 0.05)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:41:22 2011