Sequence ID | dm3.chr2R |
---|---|
Location | 17,483,984 – 17,484,050 |
Length | 66 |
Max. P | 0.989421 |
Location | 17,483,984 – 17,484,050 |
---|---|
Length | 66 |
Sequences | 3 |
Columns | 67 |
Reading direction | forward |
Mean pairwise identity | 65.96 |
Shannon entropy | 0.44478 |
G+C content | 0.72203 |
Mean single sequence MFE | -20.07 |
Consensus MFE | -11.26 |
Energy contribution | -12.60 |
Covariance contribution | 1.34 |
Combinations/Pair | 1.13 |
Mean z-score | -2.55 |
Structure conservation index | 0.56 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 2.37 |
SVM RNA-class probability | 0.989421 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 17483984 66 + 21146708 AGGCGGCAGCCAGGACAGUCGCCUGUCCCGCUGCCAC-GCCUCCCUCCCCCCUAACCCCCCCUCGAU ((((((((((..((((((....)))))).))))))..-))))......................... ( -25.20, z-score = -4.18, R) >droYak2.chr2R 9449149 55 - 21139217 AGGCGGCAGCGAGGACAGCCGCCACGCCCCCCGACACCGACCCCUUAUCCCCUGA------------ .((((((..........))))))................................------------ ( -12.70, z-score = -0.17, R) >droSec1.super_9 810997 52 + 3197100 AGGCGGCAGCCAGGACAGUCUCUUGUCCCGCUGCCAC-GCCCCCCGAACCCCU-------------- .(((((((((..((((((....)))))).))))))..-)))............-------------- ( -22.30, z-score = -3.31, R) >consensus AGGCGGCAGCCAGGACAGUCGCCUGUCCCGCUGCCAC_GCCCCCCUAACCCCU_A____________ .((((((((.(.((((((....)))))).))))))...))).......................... (-11.26 = -12.60 + 1.34)
Location | 17,483,984 – 17,484,050 |
---|---|
Length | 66 |
Sequences | 3 |
Columns | 67 |
Reading direction | reverse |
Mean pairwise identity | 65.96 |
Shannon entropy | 0.44478 |
G+C content | 0.72203 |
Mean single sequence MFE | -25.17 |
Consensus MFE | -19.86 |
Energy contribution | -20.87 |
Covariance contribution | 1.00 |
Combinations/Pair | 1.13 |
Mean z-score | -0.96 |
Structure conservation index | 0.79 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 0.77 |
SVM RNA-class probability | 0.811480 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 17483984 66 - 21146708 AUCGAGGGGGGGUUAGGGGGGAGGGAGGC-GUGGCAGCGGGACAGGCGACUGUCCUGGCUGCCGCCU .........................((((-..(((((((((((((....))))))).)))))))))) ( -30.30, z-score = -2.17, R) >droYak2.chr2R 9449149 55 + 21139217 ------------UCAGGGGAUAAGGGGUCGGUGUCGGGGGGCGUGGCGGCUGUCCUCGCUGCCGCCU ------------..........(((((.(((((..(((.(((......))).))).))))))).))) ( -20.20, z-score = 0.83, R) >droSec1.super_9 810997 52 - 3197100 --------------AGGGGUUCGGGGGGC-GUGGCAGCGGGACAAGAGACUGUCCUGGCUGCCGCCU --------------...........((((-..((((((((((((......)))))).)))))))))) ( -25.00, z-score = -1.55, R) >consensus ____________U_AGGGGAUAGGGGGGC_GUGGCAGCGGGACAGGCGACUGUCCUGGCUGCCGCCU ..............................(((((((((((((((....)))))))).))))))).. (-19.86 = -20.87 + 1.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:41:14 2011