| Sequence ID | dm3.chr2R |
|---|---|
| Location | 17,359,600 – 17,359,702 |
| Length | 102 |
| Max. P | 0.790270 |
| Location | 17,359,600 – 17,359,702 |
|---|---|
| Length | 102 |
| Sequences | 5 |
| Columns | 108 |
| Reading direction | forward |
| Mean pairwise identity | 82.29 |
| Shannon entropy | 0.31455 |
| G+C content | 0.27494 |
| Mean single sequence MFE | -22.54 |
| Consensus MFE | -12.78 |
| Energy contribution | -12.78 |
| Covariance contribution | 0.00 |
| Combinations/Pair | 1.22 |
| Mean z-score | -2.26 |
| Structure conservation index | 0.57 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.70 |
| SVM RNA-class probability | 0.790270 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 17359600 102 + 21146708 UUAGCUUGUGAUGGAAAUAGGAGUGUAUAUUGAUUAAUUUCCAUUGAAUUAAAUUUGAAAUAUUUUUUCCCA------AUGUUUCACAAGCUAAUUUGAUUUGCCUUG ((((((((((((((((((...(((........))).)))))))))...........((((((((.......)------)))))))))))))))).............. ( -23.10, z-score = -2.81, R) >droSim1.chr2R 16017838 105 + 19596830 UUAGUUUGUGAUGGAAAUAGGAGUGUAUAUUGAUUAAUUUGCAUUGAAUUAAAUUUGAAAUAUUUUUCUCAAUA---CGUAUUUCACAGGCUAAUUUGAUCAGACUUG (((((((((.((....)).((((((..(((((((((((((.....)))))))....((((....))))))))))---..))))))))))))))).............. ( -21.20, z-score = -1.52, R) >droSec1.super_9 689758 108 + 3197100 UUAGCUUGUGAUGGAAAUAGGAGUGUAUAUUGAUUAAUUUGCAUUGAAUUAAAUUUGAAAUAUUUUUCUCAAUAUUUCGUAUCUCACAGGCUAAUUUGAUCAGACUUG (((((((((((.(...(((.(((...((((((((((((((.....)))))))....((((....)))))))))))))).))))))))))))))).............. ( -23.60, z-score = -1.84, R) >droYak2.chr2R 9318759 106 - 21139217 UUAGCUUGUGCUAGAAAUAGGAGUGUAUAUUGAUUAAUUUGCAUUGAAUUAAAUUUGAAAUAUUGUUUCCCAAUA--CGUAUUUCACAGGCCAAUUUUAUUCGACUUU ...((((((((((....)))(((((..(((((.(((((((.....)))))))....(((((...))))).)))))--..))))))))))))................. ( -20.50, z-score = -1.46, R) >droEre2.scaffold_4845 11504279 99 + 22589142 UUAGCUAGCGAUGGAAAU-------UGUAUUGAUUAAUUUGCCUAGAAUUAAAUUCGAAAUAUUUUUUAACAAUA--CGUAUUUCACAGGCUAGCUUUAUUAGACUUU ..(((((((..(((((((-------(((((((.(((((((.....)))))))....((((....))))..)))))--)).))))).)).)))))))............ ( -24.30, z-score = -3.65, R) >consensus UUAGCUUGUGAUGGAAAUAGGAGUGUAUAUUGAUUAAUUUGCAUUGAAUUAAAUUUGAAAUAUUUUUUCCCAAA___CGUAUUUCACAGGCUAAUUUGAUUAGACUUG (((((((((........................(((((((.....)))))))....(((((((...............)))))))))))))))).............. (-12.78 = -12.78 + 0.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:40:56 2011