| Sequence ID | dm3.chr2R |
|---|---|
| Location | 17,089,670 – 17,089,727 |
| Length | 57 |
| Max. P | 0.694759 |
| Location | 17,089,670 – 17,089,727 |
|---|---|
| Length | 57 |
| Sequences | 5 |
| Columns | 57 |
| Reading direction | reverse |
| Mean pairwise identity | 97.19 |
| Shannon entropy | 0.05066 |
| G+C content | 0.58596 |
| Mean single sequence MFE | -16.84 |
| Consensus MFE | -17.00 |
| Energy contribution | -16.84 |
| Covariance contribution | -0.16 |
| Combinations/Pair | 1.08 |
| Mean z-score | -0.89 |
| Structure conservation index | 1.01 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.44 |
| SVM RNA-class probability | 0.694759 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 17089670 57 - 21146708 GCGACACCAACGCACAAAUUGGCGAGUGCAAGGCGCGGAACGAGUUCUGCGGGAAAC ......((...((((..........))))....(((((((....))))))))).... ( -16.70, z-score = -0.73, R) >droSim1.chr2R 15740032 57 - 19596830 GCGACACCAACGCACAAAUUGGCGAGUGCAAGGCGCGGAACGAGUUCUGCGGGAAAC ......((...((((..........))))....(((((((....))))))))).... ( -16.70, z-score = -0.73, R) >droYak2.chr2R 9032565 57 + 21139217 GCGACACCAACGCACAAAUUGGCGAGUGCAUGGCGCGGAACGAGUUCUGCGGGAAAC ......((...((((..........))))....(((((((....))))))))).... ( -16.70, z-score = -0.61, R) >droEre2.scaffold_4845 11232313 57 - 22589142 GCGACACCAACGCACAAAUUGGCGAGUGCAAGGCGCGGAACGAGUUCUGCGGGAAAC ......((...((((..........))))....(((((((....))))))))).... ( -16.70, z-score = -0.73, R) >droAna3.scaffold_13266 4863086 57 - 19884421 GCGACACCAACGCACAAAUUGGCGAGUGCAAGGCGCAGAACAAGUUCUGCGGGAAAU ......((...((((..........))))....(((((((....))))))))).... ( -17.40, z-score = -1.67, R) >consensus GCGACACCAACGCACAAAUUGGCGAGUGCAAGGCGCGGAACGAGUUCUGCGGGAAAC ......((...((((..........))))....(((((((....))))))))).... (-17.00 = -16.84 + -0.16)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:40:10 2011