| Sequence ID | dm3.chr2R |
|---|---|
| Location | 16,429,234 – 16,429,331 |
| Length | 97 |
| Max. P | 0.805180 |
| Location | 16,429,234 – 16,429,331 |
|---|---|
| Length | 97 |
| Sequences | 5 |
| Columns | 97 |
| Reading direction | reverse |
| Mean pairwise identity | 88.56 |
| Shannon entropy | 0.20463 |
| G+C content | 0.53940 |
| Mean single sequence MFE | -23.66 |
| Consensus MFE | -20.52 |
| Energy contribution | -19.72 |
| Covariance contribution | -0.80 |
| Combinations/Pair | 1.26 |
| Mean z-score | -1.56 |
| Structure conservation index | 0.87 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.75 |
| SVM RNA-class probability | 0.805180 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 16429234 97 - 21146708 GAGAAAAGUUUCCUCACAGACAAAGAGAGGAAGCGCCGGCGACAGAGACAGAAAUAUUUCGAGGGAGUGAGAUGGCGGGCGUGCGAGAGGGAGAGAG .......((((((((.(.......).))))))))(((.(((.......).....(((((((......))))))))).)))...(....)........ ( -22.50, z-score = -1.18, R) >droEre2.scaffold_4845 10573793 97 - 22589142 GAGAAAAGUUUCCUCACAGACAAAGAGAGGAAGCGCCGGCGACAGAGACAGCCAUAUCUUGAGGGAGUGAGAUGGCAGGCGCGCGAGUGGAAGAGAG .......((((((((.(.......).))))))))((((((..........)))..(((((........))))))))...(((....)))........ ( -28.40, z-score = -2.15, R) >droYak2.chr2R 8372034 92 + 21139217 GAGAAAAGUUUCCUCACAGACAAAGAGAGGAAGCGCCGACGACAGAGAUGGAAAUAUCUUGAGGGAGUGAGAUAGCAGGCGGGCGGGAGCAA----- .......((((((((.(.......).))))))))(((.((..(.((((((....))))))...)..))..(....).)))..((....))..----- ( -24.60, z-score = -2.36, R) >droSec1.super_1 13984398 97 - 14215200 GAGAAAAGUUUCCUUAUAGACAAAGAGAGGAAGCGCCGGCGACAGAGACAGCAGUAUCUUGAGGGAGUGAGAUGGCAGGCGGGUGAGAGAGAGAGAC .......((((((((...........))))))))((((....).......((..((((((........)))))))).)))................. ( -20.20, z-score = -0.99, R) >droSim1.chr2R 15087950 97 - 19596830 GAGAAAAGUUUCCUCACAGACAAAGAGAGGAAGCGCCGGCGACAGAGACAGCAGUAUCUUGAGGGAGUGAGAUGGCAGGCGGGUGAGAGAGAGAGAC .......((((((((.(.......).))))))))((((....).......((..((((((........)))))))).)))................. ( -22.60, z-score = -1.10, R) >consensus GAGAAAAGUUUCCUCACAGACAAAGAGAGGAAGCGCCGGCGACAGAGACAGCAAUAUCUUGAGGGAGUGAGAUGGCAGGCGGGCGAGAGAGAGAGAC .......((((((((.(.......).))))))))((((....)...........((((((........))))))...)))................. (-20.52 = -19.72 + -0.80)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:38:35 2011