| Sequence ID | dm3.chr2R |
|---|---|
| Location | 16,275,086 – 16,275,148 |
| Length | 62 |
| Max. P | 0.787616 |
| Location | 16,275,086 – 16,275,148 |
|---|---|
| Length | 62 |
| Sequences | 7 |
| Columns | 73 |
| Reading direction | reverse |
| Mean pairwise identity | 65.85 |
| Shannon entropy | 0.58244 |
| G+C content | 0.33179 |
| Mean single sequence MFE | -12.79 |
| Consensus MFE | -4.98 |
| Energy contribution | -4.19 |
| Covariance contribution | -0.79 |
| Combinations/Pair | 1.67 |
| Mean z-score | -1.74 |
| Structure conservation index | 0.39 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.69 |
| SVM RNA-class probability | 0.787616 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 16275086 62 - 21146708 AUGCAAGGGAAUUUAAUAUUCUCC---------GACAUUUCCGGUGAUUUGAAACCACUUG--AAAAGUCAUU ......((((((.....)))).))---------(((.((((.((((.........)))).)--))).)))... ( -14.40, z-score = -1.84, R) >droPer1.super_4 5667580 73 - 7162766 AUGUAGAAGAAGAAAGCCUUCUUCAAGUAAAAGAAAAUAUCCUGAAAUGUAGAAGAAAAUGUUAAAAGGAGUU .....(((((((.....)))))))...............((((..(((((........)))))...))))... ( -12.70, z-score = -3.10, R) >dp4.chr3 10333584 73 - 19779522 AUGUAGAAGAAGAAAGCCUUCUUCAAGUAAAAGAAAAUAUCCUCAAAUGUAGAAGAAAAUGUUCAAAGGAGUU .....(((((((.....)))))))...............((((..(((((........)))))...))))... ( -11.60, z-score = -1.81, R) >droSim1.chr2R 14930046 62 - 19596830 AUGCAAGGGAAUUUAAUAUUCUCC---------GACAUUUCUGGUGAUUUGAAACCACUUG--AAAAGUCAUU ......((((((.....)))).))---------(((.((((.((((.........)))).)--))).)))... ( -14.40, z-score = -1.94, R) >droSec1.super_1 13831903 60 - 14215200 AUGCAAGGGAAUUUAAUAUUCUCC---------GACAUUUCUGGUGAUUUGAAACCACUUG--AAAAGUCA-- ......((((((.....)))).))---------(((.((((.((((.........)))).)--))).))).-- ( -14.40, z-score = -1.98, R) >droEre2.scaffold_4845 10419022 61 - 22589142 AUGCAAGGGAAUUUAAUAUUCGCA---------GAAUUUUCUGGUGAUGUGAAACCAUUUG--AAAAGUCAU- ......(.((((.....)))).).---------((.(((((((((........))))...)--)))).))..- ( -10.60, z-score = -0.47, R) >droYak2.chr2R 8212336 58 + 21139217 ---CAAGGGAAUUUAAUAUGCCCA---------GAAAUUUCUGGUGAUUUGAAAGCACUUG--AAAAGUCGU- ---((((.(..(((((....((((---------((....))))).)..)))))..).))))--.........- ( -11.40, z-score = -1.07, R) >consensus AUGCAAGGGAAUUUAAUAUUCUCC_________GAAAUUUCUGGUGAUUUGAAACCACUUG__AAAAGUCAUU ......((((((.....))))))...................(((........)))................. ( -4.98 = -4.19 + -0.79)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:38:12 2011