| Sequence ID | dm3.chr2R |
|---|---|
| Location | 15,836,977 – 15,837,072 |
| Length | 95 |
| Max. P | 0.649671 |
| Location | 15,836,977 – 15,837,072 |
|---|---|
| Length | 95 |
| Sequences | 4 |
| Columns | 114 |
| Reading direction | reverse |
| Mean pairwise identity | 66.14 |
| Shannon entropy | 0.51636 |
| G+C content | 0.32451 |
| Mean single sequence MFE | -18.68 |
| Consensus MFE | -9.35 |
| Energy contribution | -7.72 |
| Covariance contribution | -1.63 |
| Combinations/Pair | 1.50 |
| Mean z-score | -1.34 |
| Structure conservation index | 0.50 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.34 |
| SVM RNA-class probability | 0.649671 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 15836977 95 - 21146708 -------------------GCUGUCCAUUUAAGUGGUAUUAUCAAUCCCCAGAAAUAUUACUUUUGUAUAUCUAAACAUAGUUUUAGGUUUUGAAGUGAAAAUCUCACAAAUCU -------------------.......((..((((((((((.((........))))))))))))..))..(((((((......)))))))......((((.....))))...... ( -13.80, z-score = -0.59, R) >droSim1.chr2R 14488609 95 - 19596830 -------------------GCUGUCCGUUUAAGUGGUAUUAUCAAUCCCCAGAAAUAUUACUUUCGUAUACCUAAGCAUAGCUUUAGGUUUUGAAGUGAAAAUCUCACAAAUCU -------------------............(((((((((.((........)))))))))))((((...((((((((...)).))))))..))))((((.....))))...... ( -18.00, z-score = -1.88, R) >droSec1.super_1 13319053 99 - 14215200 ---------------GCUAGCUGUCCGUUUAAGUGGUAUUAUCAAUCCCCAGAAAUAUUACUUUCGUAUACCUAAGCAUAGUUUUAGGUUUUGAAGUGAAAAUCUCACAAAUCU ---------------(((((.(((.((...((((((((((.((........)))))))))))).)).))).)).)))........(((((((((..(....)..))).)))))) ( -19.40, z-score = -2.01, R) >droAna3.scaffold_13266 10392263 112 + 19884421 GCUUUAAAAAUAAAUUAAAGCUUCUAUAUAAAAUGCCAGAGGGAAUGACUAAAAGCCAUA-UUUUAUAUAGC-AGGCCUAAGUUUAGCAAUCAAAGUGGCAUUUGCAUUAACUG (((((((.......))))))).........((((((((....((.((.(((((.(((.((-(.....)))..-.))).....))))))).))....)))))))).......... ( -23.50, z-score = -0.87, R) >consensus ___________________GCUGUCCGUUUAAGUGGUAUUAUCAAUCCCCAGAAAUAUUACUUUCGUAUACCUAAGCAUAGUUUUAGGUUUUGAAGUGAAAAUCUCACAAAUCU ................................((((.(((.(((.......((((......)))).....((((((......))))))........))).))).))))...... ( -9.35 = -7.72 + -1.63)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:36:49 2011