| Sequence ID | dm3.chr2L |
|---|---|
| Location | 3,317,855 – 3,317,909 |
| Length | 54 |
| Max. P | 0.893344 |
| Location | 3,317,855 – 3,317,909 |
|---|---|
| Length | 54 |
| Sequences | 3 |
| Columns | 54 |
| Reading direction | reverse |
| Mean pairwise identity | 95.06 |
| Shannon entropy | 0.06802 |
| G+C content | 0.36420 |
| Mean single sequence MFE | -11.07 |
| Consensus MFE | -10.94 |
| Energy contribution | -10.50 |
| Covariance contribution | -0.44 |
| Combinations/Pair | 1.15 |
| Mean z-score | -1.43 |
| Structure conservation index | 0.99 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.11 |
| SVM RNA-class probability | 0.893344 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 3317855 54 - 23011544 UGCACUGUUGUUUACUUGCUUGUAAAUUAUGUCGUGCACUAGUCGCUCAAAAUU (((((..(.((((((......))))))...)..)))))................ ( -9.70, z-score = -0.66, R) >droSec1.super_5 1460440 54 - 5866729 UGCAUUGUUGUUUACUAGCUUGUAAAUUAUGCCGUGCACUAAUCGCUCAAAAUU (((((.((.((((((......))))))...)).)))))................ ( -11.00, z-score = -1.41, R) >droSim1.chr2L 3255532 54 - 22036055 UGCACUGUUGUUUACUAGCUUGUAAAUUAUGCCGUGCACUAAUCGCUCAAAAUU (((((.((.((((((......))))))...)).)))))................ ( -12.50, z-score = -2.22, R) >consensus UGCACUGUUGUUUACUAGCUUGUAAAUUAUGCCGUGCACUAAUCGCUCAAAAUU (((((.((.((((((......))))))...)).)))))................ (-10.94 = -10.50 + -0.44)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:13:36 2011