| Sequence ID | dm3.chr2R |
|---|---|
| Location | 15,386,073 – 15,386,124 |
| Length | 51 |
| Max. P | 0.978542 |
| Location | 15,386,073 – 15,386,124 |
|---|---|
| Length | 51 |
| Sequences | 5 |
| Columns | 51 |
| Reading direction | reverse |
| Mean pairwise identity | 97.65 |
| Shannon entropy | 0.04247 |
| G+C content | 0.35294 |
| Mean single sequence MFE | -12.53 |
| Consensus MFE | -11.84 |
| Energy contribution | -11.88 |
| Covariance contribution | 0.04 |
| Combinations/Pair | 1.07 |
| Mean z-score | -2.44 |
| Structure conservation index | 0.95 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.00 |
| SVM RNA-class probability | 0.978542 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 15386073 51 - 21146708 GUGACAGUCGUGCAAUUUCAUUUGAUUUUUAUUUGCAUUGACUCACAUUUG ((((..(((((((((.................))))).))))))))..... ( -11.23, z-score = -2.11, R) >droEre2.scaffold_4845 9585275 51 - 22589142 GUGACAGUCGUGCAAUUUCUUUUGAUUUUGAUUUGCAUUGACUCACAUUUG ((((..(((((((((..((..........)).))))).))))))))..... ( -12.40, z-score = -2.28, R) >droYak2.chr2R 7349680 51 + 21139217 GUGACAGUCGUGCAAUUUCUUUUGAUUUUGAUUUGCACUGACUCACAUUUG ((((..(((((((((..((..........)).)))))).)))))))..... ( -14.20, z-score = -3.27, R) >droSec1.super_1 12904660 51 - 14215200 GUGACAGUCGUGCAAUUUCUUUUGAUUUUGAUUUGCAUUGACUCACAUUUG ((((..(((((((((..((..........)).))))).))))))))..... ( -12.40, z-score = -2.28, R) >droSim1.chrU 15504613 51 + 15797150 GUGACAGUCGUGCAAUUUCUUUUGAUUUUGAUUUGCAUUGACUCACAUUUG ((((..(((((((((..((..........)).))))).))))))))..... ( -12.40, z-score = -2.28, R) >consensus GUGACAGUCGUGCAAUUUCUUUUGAUUUUGAUUUGCAUUGACUCACAUUUG ((((..(((((((((..((..........)).)))))).)))))))..... (-11.84 = -11.88 + 0.04)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:34:56 2011