| Sequence ID | dm3.chr2R |
|---|---|
| Location | 14,903,870 – 14,903,932 |
| Length | 62 |
| Max. P | 0.998858 |
| Location | 14,903,870 – 14,903,932 |
|---|---|
| Length | 62 |
| Sequences | 4 |
| Columns | 62 |
| Reading direction | forward |
| Mean pairwise identity | 77.15 |
| Shannon entropy | 0.37658 |
| G+C content | 0.66921 |
| Mean single sequence MFE | -18.73 |
| Consensus MFE | -14.20 |
| Energy contribution | -15.20 |
| Covariance contribution | 1.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | -2.36 |
| Structure conservation index | 0.76 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.43 |
| SVM RNA-class probability | 0.990625 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 14903870 62 + 21146708 ACCACUCACAGCGCACACCACCCAUCGCCCACCACCGCCCACUGCUUUCGAGUGGGCGGUAG ..........(((............))).....((((((((((.......)))))))))).. ( -20.20, z-score = -3.47, R) >droSim1.chr2R 13603010 62 + 19596830 ACCACCCACAGCGCACACCACCCAACACCCACCACCACCCACUGCUUUCGAGUGGGCGGUAG .................................(((.((((((.......)))))).))).. ( -14.20, z-score = -1.76, R) >droSec1.super_1 12410251 62 + 14215200 ACCACCCACAGCGCACACCACCCAACGCCCACCACCACCCACUGCUUUCGAGUGGGCGGUAG ..........(((............))).....(((.((((((.......)))))).))).. ( -15.40, z-score = -1.81, R) >droAna3.scaffold_13266 2457747 55 - 19884421 -------GUCGCCUUUGGAGCCCGGACCCCAGCUCCGCCCACCGCUUUCGAGUGGGCGGUAG -------...(((...(((((..((...)).)))))((((((((....)).))))))))).. ( -25.10, z-score = -2.40, R) >consensus ACCACCCACAGCGCACACCACCCAACGCCCACCACCACCCACUGCUUUCGAGUGGGCGGUAG .................................((((((((((.......)))))))))).. (-14.20 = -15.20 + 1.00)
| Location | 14,903,870 – 14,903,932 |
|---|---|
| Length | 62 |
| Sequences | 4 |
| Columns | 62 |
| Reading direction | reverse |
| Mean pairwise identity | 77.15 |
| Shannon entropy | 0.37658 |
| G+C content | 0.66921 |
| Mean single sequence MFE | -29.80 |
| Consensus MFE | -25.38 |
| Energy contribution | -25.12 |
| Covariance contribution | -0.25 |
| Combinations/Pair | 1.24 |
| Mean z-score | -3.28 |
| Structure conservation index | 0.85 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 3.52 |
| SVM RNA-class probability | 0.998858 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 14903870 62 - 21146708 CUACCGCCCACUCGAAAGCAGUGGGCGGUGGUGGGCGAUGGGUGGUGUGCGCUGUGAGUGGU (((((((((((((....).))))))))))))...((.((..(..((....))..)..)).)) ( -31.10, z-score = -3.60, R) >droSim1.chr2R 13603010 62 - 19596830 CUACCGCCCACUCGAAAGCAGUGGGUGGUGGUGGGUGUUGGGUGGUGUGCGCUGUGGGUGGU (((((((((((((....).))))))))))))..(((((..........)))))......... ( -27.70, z-score = -3.15, R) >droSec1.super_1 12410251 62 - 14215200 CUACCGCCCACUCGAAAGCAGUGGGUGGUGGUGGGCGUUGGGUGGUGUGCGCUGUGGGUGGU (((((((((((((....).))))))))))))..(((((..........)))))......... ( -29.60, z-score = -3.14, R) >droAna3.scaffold_13266 2457747 55 + 19884421 CUACCGCCCACUCGAAAGCGGUGGGCGGAGCUGGGGUCCGGGCUCCAAAGGCGAC------- ...((((((((((....).)))))))((((((.(....).))))))...))....------- ( -30.80, z-score = -3.23, R) >consensus CUACCGCCCACUCGAAAGCAGUGGGCGGUGGUGGGCGUUGGGUGGUGUGCGCUGUGGGUGGU (((((((((((((....).)))))))))))).........((((.....))))......... (-25.38 = -25.12 + -0.25)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:33:35 2011