| Sequence ID | dm3.chr2R |
|---|---|
| Location | 13,324,957 – 13,325,019 |
| Length | 62 |
| Max. P | 0.910935 |
| Location | 13,324,957 – 13,325,019 |
|---|---|
| Length | 62 |
| Sequences | 5 |
| Columns | 74 |
| Reading direction | forward |
| Mean pairwise identity | 76.99 |
| Shannon entropy | 0.40714 |
| G+C content | 0.39701 |
| Mean single sequence MFE | -11.56 |
| Consensus MFE | -6.58 |
| Energy contribution | -6.78 |
| Covariance contribution | 0.20 |
| Combinations/Pair | 1.00 |
| Mean z-score | -2.06 |
| Structure conservation index | 0.57 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.21 |
| SVM RNA-class probability | 0.910935 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 13324957 62 + 21146708 UCUUGAGCUCCUGCUCUGACUCUUGUCUUG-------UGUG--GUUUUUUUUUUGCCAAAUAAC---CUGAAAA ....((((....)))).(((....)))(((-------(.((--((.........)))).)))).---....... ( -11.70, z-score = -2.52, R) >droSim1.chr2R 12066174 69 + 19596830 GCUUGAGCUCCUGCUCUGACUCUUGUCUUGAGUGUUUUUUU--UUUCCUUUUUUGCCAAAUAAC---CUGAAAA ((..((((....))))..((((.......))))........--...........))........---....... ( -9.70, z-score = -1.14, R) >droSec1.super_1 10826233 63 + 14215200 GCUUGAGCUCCUGCUCUGACUCUUGUCUUG------UUGUU--UUUUCUUUUUUGCCAAAUAAC---CUGAAAA ....((((....)))).(((....)))..(------(((((--(...(......)..)))))))---....... ( -9.40, z-score = -1.95, R) >droYak2.chr2R 2996036 74 - 21139217 GCUUGAGCUCCUGCUCUGCCUCUUGUCUUGUUGUUUUUUACGAUUUUUUUUGUUGCCGAAUAACAAGCUGAAAA ((..((((....)))).)).((..(.((((((((((...((((......))))....))))))))))).))... ( -18.50, z-score = -3.72, R) >droEre2.scaffold_4845 10064175 58 - 22589142 GCUUGAGCUCCUGCUCUGACUCGUGUCUCGUUCUUUUUU-------------UUGCCGAAUAAC---CUGAAAA ((..((((....)))).(((....)))............-------------..))........---....... ( -8.50, z-score = -0.96, R) >consensus GCUUGAGCUCCUGCUCUGACUCUUGUCUUG____UUUUUUU__UUUUCUUUUUUGCCAAAUAAC___CUGAAAA ....((((....)))).(((....)))............................................... ( -6.58 = -6.78 + 0.20)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:29:51 2011