| Sequence ID | dm3.chr2R |
|---|---|
| Location | 13,135,336 – 13,135,391 |
| Length | 55 |
| Max. P | 0.896056 |
| Location | 13,135,336 – 13,135,391 |
|---|---|
| Length | 55 |
| Sequences | 9 |
| Columns | 56 |
| Reading direction | reverse |
| Mean pairwise identity | 96.38 |
| Shannon entropy | 0.08088 |
| G+C content | 0.27879 |
| Mean single sequence MFE | -7.06 |
| Consensus MFE | -7.02 |
| Energy contribution | -7.03 |
| Covariance contribution | 0.01 |
| Combinations/Pair | 1.09 |
| Mean z-score | -1.41 |
| Structure conservation index | 0.99 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.13 |
| SVM RNA-class probability | 0.896056 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 13135336 55 - 21146708 CAAAUGUGACAACUUGUUACAAAAUUCAUCAACUUAUGAAAUAUAAAUC-ACACAC ....((((((.....))))))...(((((......))))).........-...... ( -7.30, z-score = -1.57, R) >droSim1.chr2R_random 2540546 55 - 2996586 CAAAUGUGACAACUUGUUACAAAAUUCAUCAACUUAUGAAAUAUAAAUC-ACACAC ....((((((.....))))))...(((((......))))).........-...... ( -7.30, z-score = -1.57, R) >droSec1.super_1 10634142 55 - 14215200 CAAAUGUGACAACUUGUUACAAAAUUCAUCAACUUAUGAAAUAUAAAUC-ACACAC ....((((((.....))))))...(((((......))))).........-...... ( -7.30, z-score = -1.57, R) >droYak2.chr2R 2799544 55 + 21139217 CAAAUGUGACAAGUUGUUACAAAAUUCAUCAACUUAUGAAAUAUAAAUC-ACACAC ....((((((.....))))))...(((((......))))).........-...... ( -7.30, z-score = -0.88, R) >droEre2.scaffold_4845 9866073 55 + 22589142 CAAAUGUGACAACUUGUUACAAAAUUCAUCAACUUAUGAAAUAUAAAUC-ACACAC ....((((((.....))))))...(((((......))))).........-...... ( -7.30, z-score = -1.57, R) >droAna3.scaffold_13266 6394642 55 + 19884421 CAAAUGUGACAACUUGUUACAAAAUUCAUCAGCUUAUGAAAUAUAAAUC-ACACAC ....((((((.....))))))...(((((......))))).........-...... ( -7.30, z-score = -1.44, R) >dp4.chr3 16703592 55 - 19779522 CAAAUGUGACAACUUGUUACAAAAUUCAUCAACUUAUGAAAUAUAAAUC-ACACAC ....((((((.....))))))...(((((......))))).........-...... ( -7.30, z-score = -1.57, R) >droPer1.super_4 7095059 55 + 7162766 CAAAUGUGACAGCUUGUUACAAAAUUCAUCAACUUAUGAAAUAUAAAUC-ACACAC ....((((((.....))))))...(((((......))))).........-...... ( -7.30, z-score = -1.44, R) >droGri2.scaffold_15245 1322504 55 - 18325388 CAAAUGCGACAACUUGUUACAAAAUUCAUAAACUUGUGAAAUAUAAAUCAACCCA- ....((..((.....))..))...((((((....))))))...............- ( -5.10, z-score = -1.12, R) >consensus CAAAUGUGACAACUUGUUACAAAAUUCAUCAACUUAUGAAAUAUAAAUC_ACACAC ....((((((.....))))))...(((((......)))))................ ( -7.02 = -7.03 + 0.01)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:29:26 2011