| Sequence ID | dm3.chr2R |
|---|---|
| Location | 13,112,110 – 13,112,160 |
| Length | 50 |
| Max. P | 0.741893 |
| Location | 13,112,110 – 13,112,160 |
|---|---|
| Length | 50 |
| Sequences | 7 |
| Columns | 53 |
| Reading direction | forward |
| Mean pairwise identity | 81.74 |
| Shannon entropy | 0.36171 |
| G+C content | 0.35264 |
| Mean single sequence MFE | -9.74 |
| Consensus MFE | -7.14 |
| Energy contribution | -7.39 |
| Covariance contribution | 0.25 |
| Combinations/Pair | 1.33 |
| Mean z-score | -1.39 |
| Structure conservation index | 0.73 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.56 |
| SVM RNA-class probability | 0.741893 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 13112110 50 + 21146708 UGUGUGAAUUGUUUGCGGCUG---AUUGCGGUUCUUAAUUUGCUUAAAGAUAU ...(..(((((...((.((..---...)).))...)))))..).......... ( -10.70, z-score = -1.68, R) >droEre2.scaffold_4845 9847657 50 - 22589142 UGUGUGAAUUGUUUGCGGCUG---AUUGCGGUUCUUAAUUUGCUUAAAGAUAU ...(..(((((...((.((..---...)).))...)))))..).......... ( -10.70, z-score = -1.68, R) >droYak2.chr2R 2780569 50 - 21139217 UGUGUGAAUUGUUUGCGGCUG---AUUGCGGUUCUUAAUUUGCUUAAAGAUAU ...(..(((((...((.((..---...)).))...)))))..).......... ( -10.70, z-score = -1.68, R) >droSec1.super_1 10615622 50 + 14215200 UGUGUGAAUUGUUUGCGGCUG---AUUGCGGUUCUUAAUUUGCUUAAAGUUAU ...(..(((((...((.((..---...)).))...)))))..).......... ( -10.70, z-score = -1.74, R) >droSim1.chr2R 11844375 50 + 19596830 UGUGUGAAUUGUUUGCGGCUG---AUUGCGGUUCUUAAUUUGCUUAAAGAUAU ...(..(((((...((.((..---...)).))...)))))..).......... ( -10.70, z-score = -1.68, R) >droAna3.scaffold_13266 6378059 50 - 19884421 UGUGUGAAUUGUUUGCGGCUG---AUUGCGGUCCUUAAUUUGCUUAAACUUAU ...(..(((((...((.((..---...)).))...)))))..).......... ( -10.00, z-score = -1.48, R) >triCas2.ChLG8 10537615 52 + 15773733 -CUGUAAAAGGUUAGAAAUCGUGCAUCUUUAUGAACAAACUGUUUAAUGAAAA -.((((...(((.....))).))))..(((((((((.....)))).))))).. ( -4.70, z-score = 0.20, R) >consensus UGUGUGAAUUGUUUGCGGCUG___AUUGCGGUUCUUAAUUUGCUUAAAGAUAU ...((((((((...((.((........)).))...)))))))).......... ( -7.14 = -7.39 + 0.25)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:29:23 2011