| Sequence ID | dm3.chr2L |
|---|---|
| Location | 3,100,246 – 3,100,298 |
| Length | 52 |
| Max. P | 0.957967 |
| Location | 3,100,246 – 3,100,298 |
|---|---|
| Length | 52 |
| Sequences | 5 |
| Columns | 59 |
| Reading direction | forward |
| Mean pairwise identity | 64.60 |
| Shannon entropy | 0.58836 |
| G+C content | 0.38210 |
| Mean single sequence MFE | -10.50 |
| Consensus MFE | -6.02 |
| Energy contribution | -6.30 |
| Covariance contribution | 0.28 |
| Combinations/Pair | 1.50 |
| Mean z-score | -1.37 |
| Structure conservation index | 0.57 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.65 |
| SVM RNA-class probability | 0.957967 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 3100246 52 + 23011544 -----CGGAUUUAGUGCAACUAUUUAUCAUACCCUUCCAGAGGGUAUGCUCCAAAUG-- -----.(((..(((.....))).....(((((((((...))))))))).))).....-- ( -14.30, z-score = -2.68, R) >droSim1.chr2L 3038674 52 + 22036055 -----CGGUUUUAAUGCAACUAUUUAUCACACCUUUCCAGAGGGUAUGCUCCAAAUU-- -----.((.....((((((....))......((((....))))))))...)).....-- ( -4.30, z-score = 1.06, R) >droYak2.chr2L 3092134 52 + 22324452 -----CAGCUUUAAUGCAACGGUUUAGUAUACCCUUCCAGAGGGUAUGCUUCUAAUU-- -----..((......))...((...(((((((((((...))))))))))).))....-- ( -16.50, z-score = -3.28, R) >droEre2.scaffold_4929 3143270 52 + 26641161 -----CAGCUCUAAUGCAACUAUUUACUAUACCCUUCCAGAGGGUAUGCUCCUAUGU-- -----..((......))..........(((((((((...))))))))).........-- ( -11.40, z-score = -1.42, R) >droMoj3.scaffold_6500 9168068 58 - 32352404 GAAAACCACCUUAAAAUAUUUAAGAACU-CAUUUCUUUACAGGGUAUCUUUCAGUAUUU .............(((((((.(((((((-(...........)))).))))..))))))) ( -6.00, z-score = -0.50, R) >consensus _____CAGCUUUAAUGCAACUAUUUACUAUACCCUUCCAGAGGGUAUGCUCCAAAUU__ ...........................((((((((.....))))))))........... ( -6.02 = -6.30 + 0.28)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:13:04 2011