| Sequence ID | dm3.chr2R |
|---|---|
| Location | 12,435,916 – 12,435,981 |
| Length | 65 |
| Max. P | 0.500000 |
| Location | 12,435,916 – 12,435,981 |
|---|---|
| Length | 65 |
| Sequences | 6 |
| Columns | 65 |
| Reading direction | forward |
| Mean pairwise identity | 100.00 |
| Shannon entropy | -0.00000 |
| G+C content | 0.26154 |
| Mean single sequence MFE | -9.20 |
| Consensus MFE | -9.20 |
| Energy contribution | -9.20 |
| Covariance contribution | 0.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | -0.83 |
| Structure conservation index | 1.00 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.01 |
| SVM RNA-class probability | 0.500000 |
| Prediction | OTHER |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 12435916 65 + 21146708 CUCAUUGAGGCGGGUAAUUGAUUUAUGUAUUUAUACUGAUUUUUUAAUUAAUUUAUAAGCUUUGC ......(((((..((((((((((.....(((......))).....)))))).))))..))))).. ( -9.20, z-score = -0.83, R) >droSec1.super_1 9934080 65 + 14215200 CUCAUUGAGGCGGGUAAUUGAUUUAUGUAUUUAUACUGAUUUUUUAAUUAAUUUAUAAGCUUUGC ......(((((..((((((((((.....(((......))).....)))))).))))..))))).. ( -9.20, z-score = -0.83, R) >droSim1.chr2R 11169748 65 + 19596830 CUCAUUGAGGCGGGUAAUUGAUUUAUGUAUUUAUACUGAUUUUUUAAUUAAUUUAUAAGCUUUGC ......(((((..((((((((((.....(((......))).....)))))).))))..))))).. ( -9.20, z-score = -0.83, R) >droYak2.chr2R 4589309 65 - 21139217 CUCAUUGAGGCGGGUAAUUGAUUUAUGUAUUUAUACUGAUUUUUUAAUUAAUUUAUAAGCUUUGC ......(((((..((((((((((.....(((......))).....)))))).))))..))))).. ( -9.20, z-score = -0.83, R) >droEre2.scaffold_4845 9163629 65 - 22589142 CUCAUUGAGGCGGGUAAUUGAUUUAUGUAUUUAUACUGAUUUUUUAAUUAAUUUAUAAGCUUUGC ......(((((..((((((((((.....(((......))).....)))))).))))..))))).. ( -9.20, z-score = -0.83, R) >droAna3.scaffold_13266 15804708 65 + 19884421 CUCAUUGAGGCGGGUAAUUGAUUUAUGUAUUUAUACUGAUUUUUUAAUUAAUUUAUAAGCUUUGC ......(((((..((((((((((.....(((......))).....)))))).))))..))))).. ( -9.20, z-score = -0.83, R) >consensus CUCAUUGAGGCGGGUAAUUGAUUUAUGUAUUUAUACUGAUUUUUUAAUUAAUUUAUAAGCUUUGC ......(((((..((((((((((.....(((......))).....)))))).))))..))))).. ( -9.20 = -9.20 + 0.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:27:38 2011