| Sequence ID | dm3.chr2R |
|---|---|
| Location | 12,313,839 – 12,313,898 |
| Length | 59 |
| Max. P | 0.768116 |
| Location | 12,313,839 – 12,313,898 |
|---|---|
| Length | 59 |
| Sequences | 8 |
| Columns | 69 |
| Reading direction | forward |
| Mean pairwise identity | 71.43 |
| Shannon entropy | 0.55223 |
| G+C content | 0.51425 |
| Mean single sequence MFE | -19.38 |
| Consensus MFE | -7.16 |
| Energy contribution | -7.98 |
| Covariance contribution | 0.81 |
| Combinations/Pair | 1.17 |
| Mean z-score | -1.96 |
| Structure conservation index | 0.37 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.63 |
| SVM RNA-class probability | 0.768116 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 12313839 59 + 21146708 -UGGGCUGGCUGUGUGCUGUCA--GUUGUUCUGGCAGCGAAAAAUGUUUUUUCUUGGCCGGA------- -....((((((....(((((((--(.....))))))))(((((.....)))))..)))))).------- ( -24.10, z-score = -3.76, R) >dp4.chr3 15948126 50 - 19779522 ------------UAGACAGACAACGUAGUUCUGGCAGCGAGAAAUGUUUUGACUUGGCCGGA------- ------------.................((((((..(((((....))))).....))))))------- ( -10.10, z-score = -0.15, R) >droAna3.scaffold_13266 15688820 60 + 19884421 UGGACAGACUUCUGUGCUGACA--GUUGUUCUGGCAGCGAAAAAUGUUUUGUCCUGGCCGGA------- .((((((((.....(((((.((--(.....))).)))))......).)))))))........------- ( -18.20, z-score = -1.15, R) >droEre2.scaffold_4845 9042971 59 - 22589142 -UGGGCUGGCUGUGUGCUGUCA--GUUGUUCUGGCAGCGAAAAAUGUUUUGUCUUGGCCGGA------- -....((((((....(((((((--(.....))))))))((((....)))).....)))))).------- ( -21.10, z-score = -2.51, R) >droYak2.chr2R 4466634 59 - 21139217 -UGGGCUGGCUGUGUGCUGUUG--GUUGUUCUGGCAGCGAAAAAUGUUUUGUCUUGGCCGGA------- -....((((((....(((((..--(.....)..)))))((((....)))).....)))))).------- ( -18.90, z-score = -2.08, R) >droSec1.super_1 9811435 59 + 14215200 -UGGGCUGGCUGUGUGCUGUCA--GUUGUUCUGGCAGCGAAAAAUGUUUUGUCUUGGCCGGA------- -....((((((....(((((((--(.....))))))))((((....)))).....)))))).------- ( -21.10, z-score = -2.51, R) >droSim1.chr2R 11046642 59 + 19596830 -UGGGCUGGCUGUGUGCUGUCA--GUUGUUCUGGCAGCGAAAAAUGUUUUGUCUUGGCCGGA------- -....((((((....(((((((--(.....))))))))((((....)))).....)))))).------- ( -21.10, z-score = -2.51, R) >droVir3.scaffold_12875 18831526 63 + 20611582 -UGGCCAAGUCGCGUGCAUUUG----AGAUUUG-CUGCACAAAAACUGUCGGAGCAGGAGACUUGUGCG -..((((((((.(.(((.((((----(.(((((-.....))))...).)))))))).).)))))).)). ( -20.40, z-score = -1.03, R) >consensus _UGGGCUGGCUGUGUGCUGUCA__GUUGUUCUGGCAGCGAAAAAUGUUUUGUCUUGGCCGGA_______ .............................((((((.((((((....))))))....))))))....... ( -7.16 = -7.98 + 0.81)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:27:17 2011