Sequence ID | dm3.chr2R |
---|---|
Location | 11,818,973 – 11,819,024 |
Length | 51 |
Max. P | 0.998940 |
Location | 11,818,973 – 11,819,024 |
---|---|
Length | 51 |
Sequences | 5 |
Columns | 53 |
Reading direction | forward |
Mean pairwise identity | 75.29 |
Shannon entropy | 0.43588 |
G+C content | 0.50588 |
Mean single sequence MFE | -14.41 |
Consensus MFE | -10.64 |
Energy contribution | -10.88 |
Covariance contribution | 0.24 |
Combinations/Pair | 1.23 |
Mean z-score | -1.00 |
Structure conservation index | 0.74 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 0.52 |
SVM RNA-class probability | 0.729582 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 11818973 51 + 21146708 CUAGAUAAGCAACGCUCGCUGAACGUGUGUGUGCGUGCGUCGCUUUGUUUC-- ..((((((((.((((.(((...((....))..))).)))).)).)))))).-- ( -16.20, z-score = -1.21, R) >droSim1.chr2R 10557619 51 + 19596830 CUAGCUAAGCAACGCUCGCUGAACGUGUGUGUGCGUGCGUCGCUUUGUUUC-- ..(((.((((.((((.(((...((....))..))).)))).)))).)))..-- ( -17.70, z-score = -1.57, R) >droSec1.super_1 9319189 51 + 14215200 CUAGCUAAGCAACGCUCGCUGAACGUGUGUGUGCGUGCGUCGCUUUGUUUC-- ..(((.((((.((((.(((...((....))..))).)))).)))).)))..-- ( -17.70, z-score = -1.57, R) >droEre2.scaffold_4845 8550148 51 - 22589142 CUAUCUAAGCAACGCUCGCUGAACGUGUGUGUGCGUGCGUCGCUUUGUUUC-- ......((((.((((.(((...((....))..))).)))).))))......-- ( -15.70, z-score = -1.67, R) >droGri2.scaffold_15245 17884872 51 - 18325388 GCGGCCAGUCAACAAU--UUGAAGAUUUUUUUUUGUUCAUGGAGUCAACUUAC ((..(((...(((((.--..............)))))..))).))........ ( -4.76, z-score = 1.03, R) >consensus CUAGCUAAGCAACGCUCGCUGAACGUGUGUGUGCGUGCGUCGCUUUGUUUC__ ......((((.((((.(((...((....))..))).)))).))))........ (-10.64 = -10.88 + 0.24)
Location | 11,818,973 – 11,819,024 |
---|---|
Length | 51 |
Sequences | 5 |
Columns | 53 |
Reading direction | reverse |
Mean pairwise identity | 75.29 |
Shannon entropy | 0.43588 |
G+C content | 0.50588 |
Mean single sequence MFE | -16.00 |
Consensus MFE | -13.52 |
Energy contribution | -13.56 |
Covariance contribution | 0.04 |
Combinations/Pair | 1.33 |
Mean z-score | -3.10 |
Structure conservation index | 0.85 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 3.56 |
SVM RNA-class probability | 0.998940 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 11818973 51 - 21146708 --GAAACAAAGCGACGCACGCACACACACGUUCAGCGAGCGUUGCUUAUCUAG --......(((((((((.(((..((....))...))).)))))))))...... ( -18.10, z-score = -3.88, R) >droSim1.chr2R 10557619 51 - 19596830 --GAAACAAAGCGACGCACGCACACACACGUUCAGCGAGCGUUGCUUAGCUAG --......(((((((((.(((..((....))...))).)))))))))...... ( -18.10, z-score = -3.22, R) >droSec1.super_1 9319189 51 - 14215200 --GAAACAAAGCGACGCACGCACACACACGUUCAGCGAGCGUUGCUUAGCUAG --......(((((((((.(((..((....))...))).)))))))))...... ( -18.10, z-score = -3.22, R) >droEre2.scaffold_4845 8550148 51 + 22589142 --GAAACAAAGCGACGCACGCACACACACGUUCAGCGAGCGUUGCUUAGAUAG --......(((((((((.(((..((....))...))).)))))))))...... ( -18.10, z-score = -4.17, R) >droGri2.scaffold_15245 17884872 51 + 18325388 GUAAGUUGACUCCAUGAACAAAAAAAAAUCUUCAA--AUUGUUGACUGGCCGC ((.(((..((....((((............)))).--...))..))).))... ( -7.60, z-score = -1.02, R) >consensus __GAAACAAAGCGACGCACGCACACACACGUUCAGCGAGCGUUGCUUAGCUAG ........(((((((((.(((.............))).)))))))))...... (-13.52 = -13.56 + 0.04)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:26:02 2011