| Sequence ID | dm3.chr2R |
|---|---|
| Location | 11,604,927 – 11,604,981 |
| Length | 54 |
| Max. P | 0.919376 |
| Location | 11,604,927 – 11,604,981 |
|---|---|
| Length | 54 |
| Sequences | 11 |
| Columns | 69 |
| Reading direction | forward |
| Mean pairwise identity | 81.16 |
| Shannon entropy | 0.32319 |
| G+C content | 0.33286 |
| Mean single sequence MFE | -11.45 |
| Consensus MFE | -8.55 |
| Energy contribution | -8.25 |
| Covariance contribution | -0.30 |
| Combinations/Pair | 1.15 |
| Mean z-score | -1.89 |
| Structure conservation index | 0.75 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.27 |
| SVM RNA-class probability | 0.919376 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 11604927 54 + 21146708 AAUUGCUCAGCGAACUGUAUUAAUCGGGGUCAUAUGCGCAAUUAUAAAGAAUAA--------------- ((((((.((..((.(((.......)))..))...)).))))))...........--------------- ( -9.10, z-score = -0.66, R) >droSec1.super_1 9098262 54 + 14215200 AAUUGCUCAGCGAACUGUAUUAAUCGGGGUCAUAUGCGCAAUUAUAAAGAAUAA--------------- ((((((.((..((.(((.......)))..))...)).))))))...........--------------- ( -9.10, z-score = -0.66, R) >droYak2.chr2R 3755214 54 - 21139217 AAUUGCUCAGCGAACUGUAUUAAUCGGGGUCAUAUGCGCAAUUAUAAAGAAUAA--------------- ((((((.((..((.(((.......)))..))...)).))))))...........--------------- ( -9.10, z-score = -0.66, R) >droEre2.scaffold_4845 8329860 54 - 22589142 AAUUGCUCAGCGAACUGUACUAAUCGGGGUCAUAUGCGCAAUUAUAAAGAAUAA--------------- ((((((.((..((.(((.......)))..))...)).))))))...........--------------- ( -9.10, z-score = -0.68, R) >droAna3.scaffold_13266 7292784 54 - 19884421 AAUUGCUCAGCGAACUGUAUUAAACAGGGUCAUAUGCGCAAUUAUAAAAAAUAA--------------- ((((((.((..((.((((.....))))..))...)).))))))...........--------------- ( -11.30, z-score = -2.30, R) >dp4.chr3 194877 69 - 19779522 AAUUGCUCUGCGAACUGUAUUAAACAGGGUCAUAUGCGCAAUUAUAAAGAAAGAACAAAUCUUGAAUAA ((((((.(((.((.((((.....))))..)).)).).)))))).......((((.....))))...... ( -9.90, z-score = -0.47, R) >droPer1.super_37 174067 69 - 760358 AAUUGCUCUGCGAACUGUAUUAAACAGGGUCAUAUGCGCAAUUAUAAAGAAAGAACAAAUCUUGAAUAA ((((((.(((.((.((((.....))))..)).)).).)))))).......((((.....))))...... ( -9.90, z-score = -0.47, R) >droWil1.scaffold_180699 1579332 53 - 2593675 AAUUGUGCAGCGAACUGUAUUAAACAGGGUCAUAUGCACAAUUAUAAGAAUAA---------------- (((((((((..((.((((.....))))..))...)))))))))..........---------------- ( -15.60, z-score = -4.13, R) >droVir3.scaffold_12823 974807 53 - 2474545 AAUUGUGCAGCGAACUGUAUUAAACAGGGUCAUAUGCACAAUUAUAAGAAUAA---------------- (((((((((..((.((((.....))))..))...)))))))))..........---------------- ( -15.60, z-score = -4.13, R) >droMoj3.scaffold_6496 414441 53 + 26866924 AAUUGCGCAGCGAACUGUAUUAAACAGGGUCAUAUGCACAAUUAUAAGAAUAA---------------- (((((.(((..((.((((.....))))..))...))).)))))..........---------------- ( -11.70, z-score = -2.35, R) >droGri2.scaffold_15245 5769857 53 + 18325388 AAUUGUGCACUGAACUGUAUUAAACAGGGUCAUAUGCACAAUUAUAAGAAAAA---------------- (((((((((.(((.((((.....))))..)))..)))))))))..........---------------- ( -15.60, z-score = -4.30, R) >consensus AAUUGCUCAGCGAACUGUAUUAAACAGGGUCAUAUGCGCAAUUAUAAAGAAAAA_______________ ((((((.((..((.(((.......)))..))...)).)))))).......................... ( -8.55 = -8.25 + -0.30)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:25:17 2011