| Sequence ID | dm3.chr2R |
|---|---|
| Location | 11,209,587 – 11,209,656 |
| Length | 69 |
| Max. P | 0.940356 |
| Location | 11,209,587 – 11,209,656 |
|---|---|
| Length | 69 |
| Sequences | 6 |
| Columns | 72 |
| Reading direction | reverse |
| Mean pairwise identity | 78.00 |
| Shannon entropy | 0.41372 |
| G+C content | 0.30283 |
| Mean single sequence MFE | -14.52 |
| Consensus MFE | -5.30 |
| Energy contribution | -7.17 |
| Covariance contribution | 1.86 |
| Combinations/Pair | 1.07 |
| Mean z-score | -3.04 |
| Structure conservation index | 0.37 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.44 |
| SVM RNA-class probability | 0.940356 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 11209587 69 - 21146708 GAAAUCAAGUCGAUUGAUUUCAGUUUCCUUCUUUUGUAUUGUUUUAUAUUUGAGCA---AUACUUACGAUAC ((((((((.....))))))))........((.(..(((((((((.......)))))---))))..).))... ( -16.10, z-score = -3.60, R) >droSim1.chr2R 9946580 69 - 19596830 GAAAUCAAGUCGAUUGAUUUCAGUUUCCUUCUUUUGUAUUGUUUUAUUUUUGAGCA---AUACUUACGAUAC ((((((((.....))))))))........((.(..(((((((((.......)))))---))))..).))... ( -16.10, z-score = -3.70, R) >droSec1.super_1 8702088 69 - 14215200 GAAAUCAAGUCGAUUGAUUUCAGUUUCCUUCUUUUGUAUUGUUUUAUUUUUGAGCA---AUACUUACGAUAC ((((((((.....))))))))........((.(..(((((((((.......)))))---))))..).))... ( -16.10, z-score = -3.70, R) >droYak2.chr2R 11137161 69 - 21139217 GAAAUCAAGUCGAUUGAUUUCAGUUUCCUUCUUUUGUAUUGUUUUAUUUUUGGGCA---AUACUUACGAUAC ((((((((.....))))))))........((.(..(((((((((.......)))))---))))..).))... ( -15.20, z-score = -3.04, R) >droEre2.scaffold_4845 7933873 69 + 22589142 GAAAUCAAGUCGAUUGAUUUCAGUUUGCUUCUUUUGUAUUGUUUUAUUUUUGGGCA---AUACUUACGAUAC ((((((((.....))))))))........((.(..(((((((((.......)))))---))))..).))... ( -15.20, z-score = -2.93, R) >droMoj3.scaffold_6496 24187361 62 + 26866924 ----------GGCGUAACAACAAAGAGCAUUUAUUCGCUUGCUCAAAUGCUAAUCAUCUAUAAUCACAAUAA ----------(((((....))...(((((..........)))))....)))..................... ( -8.40, z-score = -1.25, R) >consensus GAAAUCAAGUCGAUUGAUUUCAGUUUCCUUCUUUUGUAUUGUUUUAUUUUUGAGCA___AUACUUACGAUAC ((((((((.....))))))))..............(((((((.......................))))))) ( -5.30 = -7.17 + 1.86)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:24:38 2011