Sequence ID | dm3.chr2R |
---|---|
Location | 10,855,401 – 10,855,453 |
Length | 52 |
Max. P | 0.521947 |
Location | 10,855,401 – 10,855,453 |
---|---|
Length | 52 |
Sequences | 6 |
Columns | 56 |
Reading direction | forward |
Mean pairwise identity | 76.92 |
Shannon entropy | 0.43514 |
G+C content | 0.50037 |
Mean single sequence MFE | -15.57 |
Consensus MFE | -9.41 |
Energy contribution | -8.58 |
Covariance contribution | -0.83 |
Combinations/Pair | 1.57 |
Mean z-score | -1.22 |
Structure conservation index | 0.60 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 0.06 |
SVM RNA-class probability | 0.521947 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 10855401 52 + 21146708 UUGGUUGUUGUCGCUCCACGUUUAUUGUGGCUGUUGC--ACAGCGGAAAAAAAC-- ((.(((((.((.((.(((((.....)))))..)).))--))))).)).......-- ( -14.60, z-score = -1.33, R) >droSim1.chr2R 9615776 53 + 19596830 UUGGUUGUUGUCGCUCCACGUUUCUUGUGGCUGUUGC--ACAGCGGAAAAAAAGC- ((.(((((.((.((.(((((.....)))))..)).))--))))).))........- ( -14.60, z-score = -0.83, R) >droSec1.super_1 8367973 53 + 14215200 UUGGUUGUUGUCGCUCCACGUUUCUUGUGGCUGUUGC--ACAGCGGAAAAAAAAC- ((.(((((.((.((.(((((.....)))))..)).))--))))).))........- ( -14.60, z-score = -1.21, R) >droYak2.chr2R 10785587 51 + 21139217 UUGGUUGUUGUCGCUCCGCGUUUAUUGUGGCUGCUGC--ACAGCGGAAAAGCC--- ((.(((((.((.((.(((((.....)))))..)).))--))))).))......--- ( -15.70, z-score = -0.59, R) >droEre2.scaffold_4845 7590856 51 - 22589142 UUGGUUGUUGUCGCUCCACGUUACUUGUGGCUGCUGC--ACAGCGGAAAAACC--- ((.(((((.((.((.(((((.....)))))..)).))--))))).))......--- ( -16.10, z-score = -1.31, R) >droAna3.scaffold_13266 17415068 56 - 19884421 UUAGUUGUUUUCGCUGGUUGCUGGUUGUUGUCGCUGCUGGUGGCACGGAGAGAAAU .......(((((.(((((..(..((.((....)).))..)..)).))).))))).. ( -17.80, z-score = -2.04, R) >consensus UUGGUUGUUGUCGCUCCACGUUUCUUGUGGCUGCUGC__ACAGCGGAAAAAAA___ ((.(((((....((.(((((.....)))))..)).....))))).))......... ( -9.41 = -8.58 + -0.83)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:23:48 2011