| Sequence ID | dm3.chr2R |
|---|---|
| Location | 10,804,560 – 10,804,651 |
| Length | 91 |
| Max. P | 0.506830 |
| Location | 10,804,560 – 10,804,651 |
|---|---|
| Length | 91 |
| Sequences | 6 |
| Columns | 97 |
| Reading direction | forward |
| Mean pairwise identity | 81.21 |
| Shannon entropy | 0.32581 |
| G+C content | 0.31951 |
| Mean single sequence MFE | -14.52 |
| Consensus MFE | -9.44 |
| Energy contribution | -9.22 |
| Covariance contribution | -0.22 |
| Combinations/Pair | 1.05 |
| Mean z-score | -1.57 |
| Structure conservation index | 0.65 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.02 |
| SVM RNA-class probability | 0.506830 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 10804560 91 + 21146708 CAUUUAAUUAGCAUUUGGCUUCUUGGUUUUAAACACAAACACACACACA------UGCACUUAGCUAAUGGAAAUUCUAUGCCAAAAUUAAUUAACU ...((((((((..((((((..............................------.((.....))..((((.....)))))))))).)))))))).. ( -12.50, z-score = -1.02, R) >droYak2.chr2R 10733787 93 + 21139217 CAUUUAAUUAGCAUUUGGCUUCUUGGAUUUACACACACAUGCACAUACACA----UACACUUAGCUAAUGGAAAUUCUAUGCCAAAUUUAAUUAACU ...((((((((.(((((((.....((((((...((.....((.........----........))...)).))))))...))))))))))))))).. ( -15.63, z-score = -2.90, R) >droEre2.scaffold_4845 7540413 85 - 22589142 CAUUUAAUUAGCAUUUGGCUUCUUGGUCUUACACACAGGCACACACACU------------UAGCUAAUGGAAAUUCUAUGCCAAAAUUAAUUAACU ...((((((((..((((((....((((((.......)))).))......------------......((((.....)))))))))).)))))))).. ( -14.10, z-score = -1.64, R) >droSec1.super_1 8317943 97 + 14215200 CAUUUAAUUAGCAUUUGGCUUCUUGGUUUUAAACACAAAUACACACACACACACUUGCACUUAGCUAAUGGAAAUUCUAUGCCAAAAUUAAUUAACU ...((((((((..((((((.....................................((.....))..((((.....)))))))))).)))))))).. ( -12.50, z-score = -1.18, R) >droPer1.super_2 708092 85 - 9036312 CAUUUAAUUAGCAUUUGGCUUCGCG--UUUUGCCUUUAAUGCACCUAUU----------UUUAGCUAAUGGAAAUUCUAUGCCGAAAUUAAUUAACU ...((((((((..((((((...(((--((........)))))..(((((----------.......))))).........)))))).)))))))).. ( -16.20, z-score = -1.30, R) >dp4.chr3 13293985 85 + 19779522 CAUUUAAUUAGCAUUUGGCUUCGCG--UUUCGCCUUUAAUGCACCUAUU----------UUUAGCUAAUGGAAAUUCUAUGCCGAAAUUAAUUAACU ...((((((((..((((((...(((--((........)))))..(((((----------.......))))).........)))))).)))))))).. ( -16.20, z-score = -1.36, R) >consensus CAUUUAAUUAGCAUUUGGCUUCUUGGUUUUAAACACAAAUACACACACA__________CUUAGCUAAUGGAAAUUCUAUGCCAAAAUUAAUUAACU ...((((((((..((((((.....(........).................................((((.....)))))))))).)))))))).. ( -9.44 = -9.22 + -0.22)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:23:41 2011