| Sequence ID | dm3.chr2R |
|---|---|
| Location | 10,426,682 – 10,426,735 |
| Length | 53 |
| Max. P | 0.956344 |
| Location | 10,426,682 – 10,426,735 |
|---|---|
| Length | 53 |
| Sequences | 9 |
| Columns | 61 |
| Reading direction | forward |
| Mean pairwise identity | 75.40 |
| Shannon entropy | 0.48302 |
| G+C content | 0.34061 |
| Mean single sequence MFE | -11.29 |
| Consensus MFE | -6.89 |
| Energy contribution | -6.51 |
| Covariance contribution | -0.38 |
| Combinations/Pair | 1.27 |
| Mean z-score | -1.75 |
| Structure conservation index | 0.61 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.63 |
| SVM RNA-class probability | 0.956344 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 10426682 53 + 21146708 CCGAGCACUUGCCAUGCAUGAAGUUAUUUAAUAAA-----AAUUGAAUGGCUCUCCCU--- ..((((.(.(((...))).)....((((((((...-----.)))))))))))).....--- ( -9.50, z-score = -1.28, R) >droSec1.super_1 7940656 53 + 14215200 CCGAGCACUUGCCAUGCAUGAAGUUAUUUAAUAAA-----AAUUGAAUGGCUCUCCCU--- ..((((.(.(((...))).)....((((((((...-----.)))))))))))).....--- ( -9.50, z-score = -1.28, R) >droYak2.chr2R 10354471 56 + 21139217 CAGGGCACUUGCCAUGCAUGAAGUUAUUUAAUAAA-----AAUUGAAUGGCUCUCCUCUCU ...(((....)))......(((((((((((((...-----.))))))))))).))...... ( -12.20, z-score = -1.16, R) >droEre2.scaffold_4845 7160505 56 - 22589142 CAGAGCACUUGCCAUGCAUGAAGUUAUUUAAUAAA-----AAUUGAAUGGCUCUCCUCUCA .((((....(((...))).(((((((((((((...-----.))))))))))).)))))).. ( -10.30, z-score = -0.80, R) >droAna3.scaffold_13266 10823736 56 + 19884421 CGAAGCAUUUGCCAUGCAUGAAGUUAUUUAAUAAA-----AAUUGAAUGGCUCUCCUCCCU ....((((.....))))..(((((((((((((...-----.))))))))))).))...... ( -10.60, z-score = -1.57, R) >dp4.chr3 5060877 58 + 19779522 --AGGGGGAUGCCAUGCAUGAAGUUAUUUAAUAUAA-AAAAAUUGAAUGCUUUUUCCCCUU --(((((((......((((..((((.(((......)-)).))))..))))....))))))) ( -15.70, z-score = -2.18, R) >droWil1.scaffold_180701 992900 51 + 3904529 CCAAAUAUUUGGCAUGCAUGAAGUUAUUUAAUAAA-----AAUUGAAUAGCUUUUC----- ((((....)))).......(((((((((((((...-----.)))))))))))))..----- ( -11.10, z-score = -2.12, R) >droVir3.scaffold_12875 10517602 54 - 20611582 CUAAACAUUUGGCAUGCAUGAAGUUAUUCAAUAAAAUAAAAAUUGAAUAGCUUC------- ...................(((((((((((((.........)))))))))))))------- ( -12.40, z-score = -2.98, R) >droMoj3.scaffold_6496 16936674 52 + 26866924 CCAAACAUUUGGCAUGCACGAAGUUAUUCAAUAAAAUAAAAAUUGAAUAGCU--------- ((((....)))).........(((((((((((.........)))))))))))--------- ( -10.30, z-score = -2.36, R) >consensus CCAAGCACUUGCCAUGCAUGAAGUUAUUUAAUAAA_____AAUUGAAUGGCUCUCC_C___ .....................(((((((((((.........)))))))))))......... ( -6.89 = -6.51 + -0.38)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:22:48 2011