| Sequence ID | dm3.chr2L |
|---|---|
| Location | 2,834,433 – 2,834,490 |
| Length | 57 |
| Max. P | 0.791461 |
| Location | 2,834,433 – 2,834,490 |
|---|---|
| Length | 57 |
| Sequences | 4 |
| Columns | 57 |
| Reading direction | reverse |
| Mean pairwise identity | 67.25 |
| Shannon entropy | 0.53143 |
| G+C content | 0.27310 |
| Mean single sequence MFE | -6.78 |
| Consensus MFE | -7.04 |
| Energy contribution | -6.85 |
| Covariance contribution | -0.19 |
| Combinations/Pair | 1.78 |
| Mean z-score | -0.30 |
| Structure conservation index | 1.04 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.70 |
| SVM RNA-class probability | 0.791461 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 2834433 57 - 23011544 UUAAGUUUGCAUUUAAAUAGCUGAAAGUUGGGCCUCUUUUAUUUUUUCGUUAUUUAU .............((((((((.((((((.((....))...))))))..)))))))). ( -6.50, z-score = 0.14, R) >droYak2.chr2L 2827576 56 - 22324452 UUUAUUUUACAUUUAAGUAACUUGAAGUUAAACCUCCUCUGUUGUUC-GUUACUUAU .............((((((((..(((....(((.......))).)))-)))))))). ( -6.10, z-score = -1.06, R) >droEre2.scaffold_4929 2881821 57 - 26641161 UUUAUUUUACAGUUAAGUGACUGGAAGUUAAGCCUCCUUUGUUUUUUGGUUAAUUAU .............(((.((((..((((..(((....)))...))))..)))).))). ( -7.40, z-score = -0.04, R) >triCas2.ChLG9 11838453 57 - 15222296 UUAAGUAUGCCUUUAAUAAAUUGAAAUCGGGACCAUUUCUUUUUUUCAGGUUUUCAU ....(...((((.....(((..(((((.(....))))))..)))...))))...).. ( -7.10, z-score = -0.22, R) >consensus UUAAGUUUACAUUUAAGUAACUGAAAGUUAAACCUCCUCUGUUUUUC_GUUAUUUAU .............((((((((((((((.((((.....)))).)))))))))))))). ( -7.04 = -6.85 + -0.19)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:12:23 2011