| Sequence ID | dm3.chr2R |
|---|---|
| Location | 10,219,613 – 10,219,701 |
| Length | 88 |
| Max. P | 0.655775 |
| Location | 10,219,613 – 10,219,701 |
|---|---|
| Length | 88 |
| Sequences | 5 |
| Columns | 88 |
| Reading direction | forward |
| Mean pairwise identity | 73.03 |
| Shannon entropy | 0.46739 |
| G+C content | 0.41711 |
| Mean single sequence MFE | -21.78 |
| Consensus MFE | -11.24 |
| Energy contribution | -11.72 |
| Covariance contribution | 0.48 |
| Combinations/Pair | 1.38 |
| Mean z-score | -1.51 |
| Structure conservation index | 0.52 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.35 |
| SVM RNA-class probability | 0.655775 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 10219613 88 + 21146708 GCCUACUUUUAAGCGCUGCAGUGCUAAAUGCACAAUGUUAAGUGCCCAGCGCUUAAAACUGUGCUUUAGUUUUCUUUCCCUAGUUGCU ((.((.((((((((((((..((((.....))))...((.....)).)))))))))))).)).))...(((...((......))..))) ( -24.00, z-score = -1.81, R) >droSim1.chr2R 8983269 78 + 19596830 GCCUACUUUUAUGC----------UAAGUGCACAAUGUAAAGUGCCCAGCGCUUAAAACUAUGCUUUAGUUUUGUAUGCCAAGUUGCU ((..((((....((----------(..(.((((........))))).)))((.((((((((.....))))))))...)).)))).)). ( -17.50, z-score = -0.41, R) >droSec1.super_1 7727981 88 + 14215200 GCCUACUUUUAUGCGCUGCAGUGUUAAGUGCACAAUGUUAAGUGACCAGCGCUUAAAACUGUGCUUUAAUUUUGUAUGCCAAGUUGCU ((..((((....(((.(((((.((((((.(((((...(((((((.....)))))))...))))))))))).)))))))).)))).)). ( -26.30, z-score = -1.78, R) >droYak2.chr2R 10157181 72 + 21139217 GCCUACUUUUAUGCGCUGCUGUGGUAAAUGCGCAAUGCUAAAUGCCUAGCGCUUGAAAGUUUGCUGUACUUU---------------- ((..(((((((.((((((....((((...((.....))....)))))))))).)))))))..))........---------------- ( -21.90, z-score = -2.24, R) >droEre2.scaffold_4845 6968139 72 - 22589142 GCCUACUUUUGUGCGUUGCUGUGGUAAAUGCGCAAUGUAAAAUGCUCAGCGCUUAAAAGUGUGCUUUAAUUU---------------- ((.((((((((.((((((....((((..(((.....)))...)))))))))).)))))))).))........---------------- ( -19.20, z-score = -1.29, R) >consensus GCCUACUUUUAUGCGCUGCAGUGGUAAAUGCACAAUGUUAAGUGCCCAGCGCUUAAAACUGUGCUUUAAUUUU_U_U_CC_AGUUGCU ((.((.(((((.((((((....((((...((.....))....)))))))))).))))).)).))........................ (-11.24 = -11.72 + 0.48)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:22:18 2011