| Sequence ID | dm3.chr2R |
|---|---|
| Location | 9,359,686 – 9,359,740 |
| Length | 54 |
| Max. P | 0.968615 |
| Location | 9,359,686 – 9,359,740 |
|---|---|
| Length | 54 |
| Sequences | 4 |
| Columns | 54 |
| Reading direction | forward |
| Mean pairwise identity | 79.94 |
| Shannon entropy | 0.32948 |
| G+C content | 0.55418 |
| Mean single sequence MFE | -17.90 |
| Consensus MFE | -15.23 |
| Energy contribution | -15.97 |
| Covariance contribution | 0.75 |
| Combinations/Pair | 1.00 |
| Mean z-score | -1.88 |
| Structure conservation index | 0.85 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.80 |
| SVM RNA-class probability | 0.968615 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 9359686 54 + 21146708 GCGACUGCCGCCUCGAGGCGUUUUGUGGGCACAGCCCAGAAAACAGAAGAAGAA .........(((....)))(((((.(((((...))))).))))).......... ( -18.50, z-score = -1.74, R) >droSim1.chr2R 7808102 54 + 19596830 GCGACUGCCGCCUCGAGGCGUUUUGUGGGCACAGCCCAGAAAACAGAAAGAAAA ....((..((((....)))(((((.(((((...))))).))))).)..)).... ( -18.70, z-score = -1.90, R) >droSec1.super_1 6878831 52 + 14215200 GCGACUGCCGCCUCUAGGCGUUUUGUGGGCACAGCCCAGAAAACAGAAAGAA-- ....((..((((....)))(((((.(((((...))))).))))).)..))..-- ( -18.70, z-score = -2.00, R) >droAna3.scaffold_13266 16660549 51 + 19884421 ---GCGACUGCCUCGAGGCGUUUGCCGGGCACAGCCCAAAAAAAAAAUCAACAA ---((((.((((....)))).)))).((((...))))................. ( -15.70, z-score = -1.87, R) >consensus GCGACUGCCGCCUCGAGGCGUUUUGUGGGCACAGCCCAGAAAACAGAAAAAAAA .........(((....)))(((((.(((((...))))).))))).......... (-15.23 = -15.97 + 0.75)
| Location | 9,359,686 – 9,359,740 |
|---|---|
| Length | 54 |
| Sequences | 4 |
| Columns | 54 |
| Reading direction | reverse |
| Mean pairwise identity | 79.94 |
| Shannon entropy | 0.32948 |
| G+C content | 0.55418 |
| Mean single sequence MFE | -15.78 |
| Consensus MFE | -14.29 |
| Energy contribution | -14.60 |
| Covariance contribution | 0.31 |
| Combinations/Pair | 1.08 |
| Mean z-score | -0.83 |
| Structure conservation index | 0.91 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.43 |
| SVM RNA-class probability | 0.693150 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 9359686 54 - 21146708 UUCUUCUUCUGUUUUCUGGGCUGUGCCCACAAAACGCCUCGAGGCGGCAGUCGC ........(((((((.(((((...))))).))).((((....)))))))).... ( -16.80, z-score = -1.18, R) >droSim1.chr2R 7808102 54 - 19596830 UUUUCUUUCUGUUUUCUGGGCUGUGCCCACAAAACGCCUCGAGGCGGCAGUCGC ........(((((((.(((((...))))).))).((((....)))))))).... ( -16.80, z-score = -1.22, R) >droSec1.super_1 6878831 52 - 14215200 --UUCUUUCUGUUUUCUGGGCUGUGCCCACAAAACGCCUAGAGGCGGCAGUCGC --......(((((((.(((((...))))).))).((((....)))))))).... ( -16.80, z-score = -1.16, R) >droAna3.scaffold_13266 16660549 51 - 19884421 UUGUUGAUUUUUUUUUUGGGCUGUGCCCGGCAAACGCCUCGAGGCAGUCGC--- .....((((..(((.((((((...)))))).))).(((....)))))))..--- ( -12.70, z-score = 0.23, R) >consensus UUUUCUUUCUGUUUUCUGGGCUGUGCCCACAAAACGCCUCGAGGCGGCAGUCGC ..........(((((.(((((...))))).)))))(((....)))......... (-14.29 = -14.60 + 0.31)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:20:09 2011