| Sequence ID | dm3.chr2R |
|---|---|
| Location | 8,798,153 – 8,798,215 |
| Length | 62 |
| Max. P | 0.690781 |
| Location | 8,798,153 – 8,798,215 |
|---|---|
| Length | 62 |
| Sequences | 5 |
| Columns | 62 |
| Reading direction | forward |
| Mean pairwise identity | 95.16 |
| Shannon entropy | 0.08678 |
| G+C content | 0.35806 |
| Mean single sequence MFE | -9.30 |
| Consensus MFE | -9.86 |
| Energy contribution | -9.22 |
| Covariance contribution | -0.64 |
| Combinations/Pair | 1.24 |
| Mean z-score | -0.43 |
| Structure conservation index | 1.06 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.43 |
| SVM RNA-class probability | 0.690781 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 8798153 62 + 21146708 GGUGGAGAAUGAGAAUUCUUAUAAUCAUUAGAAAAAUUGGUCAUUCGGGAGUGCUCAAAAAC (((.((((((....))))))...)))..........(((..((((....))))..))).... ( -10.10, z-score = -0.81, R) >droSim1.chr2R 7257622 62 + 19596830 GGUGGAGAAUAAGAAUUCUUAUAAUCAUUAGAAAAAUUGGUCAUUCGGGAGUGCUCAAAAAC (((.((((((....))))))...)))..........(((..((((....))))..))).... ( -9.20, z-score = -0.92, R) >droSec1.super_1 6314017 62 + 14215200 GGUGGAGAAUGAGAAUUCUUAUAAUCAUUAGAAAAAUUGGUCAUUCGGGAGUGCUCAAAAAC (((.((((((....))))))...)))..........(((..((((....))))..))).... ( -10.10, z-score = -0.81, R) >droYak2.chr2R 12966844 62 - 21139217 GGUGGAGAAUCAGAAUUCUUAUAACCAUUAGAAAAAUUGGUCAUUCGGGAGUGCUUAAAAAG (((.((((((....))))))...)))..........((((.((((....)))).)))).... ( -9.30, z-score = -0.24, R) >droEre2.scaffold_4845 5562805 62 - 22589142 GGUGGGGAAUCAGAAUUCUUAUAAUCAUUAGAAAAAUUGGUCAUUCGGGAGUGCUCAGAAAG (((.((((((....))))))...)))..........(((..((((....))))..))).... ( -7.80, z-score = 0.62, R) >consensus GGUGGAGAAUCAGAAUUCUUAUAAUCAUUAGAAAAAUUGGUCAUUCGGGAGUGCUCAAAAAC (((.((((((....))))))...)))..........((((.((((....)))).)))).... ( -9.86 = -9.22 + -0.64)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:18:57 2011