Sequence ID | dm3.chr2R |
---|---|
Location | 8,706,570 – 8,706,632 |
Length | 62 |
Max. P | 0.557806 |
Location | 8,706,570 – 8,706,632 |
---|---|
Length | 62 |
Sequences | 5 |
Columns | 63 |
Reading direction | reverse |
Mean pairwise identity | 84.13 |
Shannon entropy | 0.28696 |
G+C content | 0.26859 |
Mean single sequence MFE | -8.80 |
Consensus MFE | -4.69 |
Energy contribution | -4.38 |
Covariance contribution | -0.31 |
Combinations/Pair | 1.33 |
Mean z-score | -2.27 |
Structure conservation index | 0.53 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 0.13 |
SVM RNA-class probability | 0.557806 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 8706570 62 - 21146708 CUCGUUUUACUCCAUUUUAAUUUAUUUAAUCGAGUUCAACCA-UUUGCAUUUGUUGCAAUCAU ...(((..((((....((((.....))))..))))..)))..-.(((((.....))))).... ( -8.90, z-score = -3.13, R) >droSim1.chr2R 7181447 62 - 19596830 CUCGUUUUACUUCAUUUUAAUUUAUUUAAUCGAGUUCAACCA-UUUGCAUUUGUUGCAAUCAU ...(((..((((....((((.....))))..))))..)))..-.(((((.....))))).... ( -7.10, z-score = -1.98, R) >droSec1.super_1 6238712 62 - 14215200 CUCGUUUUACUUCAUUUUAAUUUAUUUAAUCGAGUUCAACCA-UUUGCAUUUGUUGCAAUCAU ...(((..((((....((((.....))))..))))..)))..-.(((((.....))))).... ( -7.10, z-score = -1.98, R) >droEre2.scaffold_4845 5480449 59 + 22589142 ---GUUUUACAUCAUUUUAAUGUAUUUAAUCGAGUUCAACAA-UUUGCAUUUGUUGCAAUCAU ---....(((((.......))))).......((...((((((-.......))))))...)).. ( -7.50, z-score = -0.96, R) >droPer1.super_4 4291805 60 + 7162766 UCCGUUUU-UGUUGUUUCAAUUUAAAUACUGAAA--CAAUAAUUUUGCAUUUGUUGCAAUCAU .......(-((((((((((..........)))))--))))))..(((((.....))))).... ( -13.40, z-score = -3.30, R) >consensus CUCGUUUUACUUCAUUUUAAUUUAUUUAAUCGAGUUCAACCA_UUUGCAUUUGUUGCAAUCAU ...(((..((((.(((...........))).))))..)))....(((((.....))))).... ( -4.69 = -4.38 + -0.31)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:18:45 2011