| Sequence ID | dm3.chr2R |
|---|---|
| Location | 8,605,724 – 8,605,794 |
| Length | 70 |
| Max. P | 0.856709 |
| Location | 8,605,724 – 8,605,794 |
|---|---|
| Length | 70 |
| Sequences | 7 |
| Columns | 79 |
| Reading direction | forward |
| Mean pairwise identity | 70.57 |
| Shannon entropy | 0.56680 |
| G+C content | 0.33152 |
| Mean single sequence MFE | -16.53 |
| Consensus MFE | -6.22 |
| Energy contribution | -6.40 |
| Covariance contribution | 0.17 |
| Combinations/Pair | 1.69 |
| Mean z-score | -1.99 |
| Structure conservation index | 0.38 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.94 |
| SVM RNA-class probability | 0.856709 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 8605724 70 + 21146708 AUUUCCAUCAGUAAUGCCA--AUCUAAUCCAAAGUAGAUUGGCAAAUACAGCAUUUUAAUUGGAUGGCAAAA------- .((((((((.(((.(((((--(((((........))))))))))..)))..((.......))))))).))).------- ( -20.70, z-score = -4.13, R) >droAna3.scaffold_13266 11351432 71 - 19884421 AUUUUAAAUAUUAGUUCCCUUACUUGGUCAUAAGGAAAUUGGCAAAUACCAU-UUUUAAUUGGAUUCUAAAA------- ..........((((.(((....((((....))))((((.(((......))).-))))....)))..))))..------- ( -9.50, z-score = 0.10, R) >droEre2.scaffold_4845 5386082 70 - 22589142 AUUUCCCUCAGUAAUGCCA--AUCUAAUCCAGAGUGGAUUGGCAAAUACAGCAUUUUAAUUGGAUGGCAAAA------- ..........(((.(((((--(((((........))))))))))..)))..(((((.....)))))......------- ( -16.30, z-score = -1.16, R) >droYak2.chr2R 12793635 77 - 21139217 AUUCCCAUCAGUAAUGCCA--AUCUAAUCCAGAGUGGAUUGGCAAAUACAGCAUUUUAAUUGGAUGGCAAAUGGCAAAA ....(((((.(((.(((((--(((((........))))))))))..)))..((.......)))))))............ ( -20.10, z-score = -1.54, R) >droSec1.super_1 6143979 70 + 14215200 AUUUCCAUCAGUAAUGCCA--AUCUAAUCCAAAGUAGAUUGGCAAAUACAGCAUUUUAAUUGGAUGGCAAAA------- .((((((((.(((.(((((--(((((........))))))))))..)))..((.......))))))).))).------- ( -20.70, z-score = -4.13, R) >droSim1.chr2R 7086404 70 + 19596830 AUUUCCAUCAGUAAUGCCA--AUCUAAUCCAAAGUAGAUUGGCAAAUACAGCAUUUUAAUUGGAUGGCAAAA------- .((((((((.(((.(((((--(((((........))))))))))..)))..((.......))))))).))).------- ( -20.70, z-score = -4.13, R) >anoGam1.chr3L 38790538 57 - 41284009 ------------GAUUCGAU-GUAUCAUUUGCAGCUAAUGAUUG--UAUUGCAUUCGAUUUGGAUAGUGAAA------- ------------...(((((-(((.....((((((....).)))--)).)))).))))..............------- ( -7.70, z-score = 1.06, R) >consensus AUUUCCAUCAGUAAUGCCA__AUCUAAUCCAAAGUAGAUUGGCAAAUACAGCAUUUUAAUUGGAUGGCAAAA_______ ....(((((...(((((......((((((.......))))))........))))).......)))))............ ( -6.22 = -6.40 + 0.17)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:18:30 2011