| Sequence ID | dm3.chr2L |
|---|---|
| Location | 2,596,670 – 2,596,723 |
| Length | 53 |
| Max. P | 0.929053 |
| Location | 2,596,670 – 2,596,723 |
|---|---|
| Length | 53 |
| Sequences | 6 |
| Columns | 53 |
| Reading direction | reverse |
| Mean pairwise identity | 79.12 |
| Shannon entropy | 0.40677 |
| G+C content | 0.41014 |
| Mean single sequence MFE | -10.65 |
| Consensus MFE | -7.52 |
| Energy contribution | -7.17 |
| Covariance contribution | -0.36 |
| Combinations/Pair | 1.40 |
| Mean z-score | -1.67 |
| Structure conservation index | 0.71 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.34 |
| SVM RNA-class probability | 0.929053 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 2596670 53 - 23011544 GUCUCUCAACUUUUAAAAUCUUUUCGUAAAAGGGUUUUCUGGUUCAGCUCCGC ....((.((((...((((((((((....))))))))))..)))).))...... ( -7.80, z-score = -1.58, R) >droAna3.scaffold_12913 409955 52 + 441482 GGUGCUUAAAGGAUAAAGCCCAUCUUUGAAAGGGUUUUUUCGUUGGGCUUAC- ...((((((..((.(((((((..........))))))).)).))))))....- ( -14.90, z-score = -1.86, R) >droEre2.scaffold_4929 2641175 53 - 26641161 GGCUUUCAACUUUUAAAAUCUUUUCGUAAAAGGGUUUUUCGGUUCAUCUCCGC ((.....((((...((((((((((....))))))))))..)))).....)).. ( -8.70, z-score = -2.02, R) >droYak2.chr2L 2584853 53 - 22324452 GACUCUCAACUUUUUAAAUCCUUUCGUAAAAGGGUUUUCUGGUUCAGCUACGC ....((.((((....(((((((((....)))))))))...)))).))...... ( -9.90, z-score = -1.77, R) >droSec1.super_5 764950 53 - 5866729 GGCUCUCAACUUUUAAAAUCUUUGCGUAAAAGGGUUUUCUGGUUCAGCUCCGC ((..((.((((...(((((((((......)))))))))..)))).))..)).. ( -11.70, z-score = -1.77, R) >droSim1.chr2L 2554996 53 - 22036055 GGCUCUCAACUUUUGAAAUCUUUGCGUAAAAGGGUUUUCUGGUUCAGCUUCGC ((((...((((...(((((((((......)))))))))..)))).)))).... ( -10.90, z-score = -0.99, R) >consensus GGCUCUCAACUUUUAAAAUCUUUUCGUAAAAGGGUUUUCUGGUUCAGCUCCGC ....((.((((...(((((((((......)))))))))..)))).))...... ( -7.52 = -7.17 + -0.36)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:11:47 2011