| Sequence ID | dm3.chr2R |
|---|---|
| Location | 7,654,062 – 7,654,118 |
| Length | 56 |
| Max. P | 0.983650 |
| Location | 7,654,062 – 7,654,118 |
|---|---|
| Length | 56 |
| Sequences | 5 |
| Columns | 61 |
| Reading direction | forward |
| Mean pairwise identity | 90.52 |
| Shannon entropy | 0.16449 |
| G+C content | 0.44865 |
| Mean single sequence MFE | -14.66 |
| Consensus MFE | -12.54 |
| Energy contribution | -12.58 |
| Covariance contribution | 0.04 |
| Combinations/Pair | 1.06 |
| Mean z-score | -2.66 |
| Structure conservation index | 0.86 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.14 |
| SVM RNA-class probability | 0.983650 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 7654062 56 + 21146708 UUUAGCUAUUUGCAUAUAAAUGCAACUUGAGACGCUGCCAACCAGCAGCCGC--AACA--- ....((...((((((....))))))........(((((......))))).))--....--- ( -14.60, z-score = -2.39, R) >droSim1.chr2R 6181144 56 + 19596830 UUUAGCUAUUUGCAUAUAAAUGCAACCUGAGACGCUGCCAACCAGCAGCCGC--AACA--- ....((...((((((....))))))........(((((......))))).))--....--- ( -14.60, z-score = -2.67, R) >droSec1.super_1 5206350 56 + 14215200 UUUAGCUAUUUGCAUAUAAAUGCAACCUGAGACGCUGCCAACCAGCAGCCGC--AACA--- ....((...((((((....))))))........(((((......))))).))--....--- ( -14.60, z-score = -2.67, R) >droEre2.scaffold_4845 4446691 61 - 22589142 UUUAGCUAUUUGCAUAUAAAUGCAACCUGAGACGCUGCCAACCAGCAGCAGCCGACCAACA .(..(((..((((((....))))))........(((((......))))))))..)...... ( -15.80, z-score = -3.24, R) >droAna3.scaffold_13266 6634426 56 - 19884421 UUUAGAUAUUUGCAUAUAAAUGAAACCUGAGAAGCUGCCAACCGGCAGCUGC--AAUA--- .........((((........(....).....(((((((....)))))))))--))..--- ( -13.70, z-score = -2.33, R) >consensus UUUAGCUAUUUGCAUAUAAAUGCAACCUGAGACGCUGCCAACCAGCAGCCGC__AACA___ (((((....((((((....)))))).)))))..(((((......)))))............ (-12.54 = -12.58 + 0.04)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:16:08 2011