| Sequence ID | dm3.chr2L |
|---|---|
| Location | 2,548,780 – 2,548,870 |
| Length | 90 |
| Max. P | 0.812276 |
| Location | 2,548,780 – 2,548,870 |
|---|---|
| Length | 90 |
| Sequences | 4 |
| Columns | 90 |
| Reading direction | forward |
| Mean pairwise identity | 59.13 |
| Shannon entropy | 0.65354 |
| G+C content | 0.28798 |
| Mean single sequence MFE | -13.62 |
| Consensus MFE | -7.82 |
| Energy contribution | -6.45 |
| Covariance contribution | -1.37 |
| Combinations/Pair | 1.60 |
| Mean z-score | -0.62 |
| Structure conservation index | 0.57 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.77 |
| SVM RNA-class probability | 0.812276 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 2548780 90 + 23011544 AGAAAAUUUGUACGAAAUAUAUAGGGUAGGGUUUGAAUUAAAUAUUCCUUAUAUCCUGUGUAUGCUAAUUUAAAACCAGGGAAACAAAAA ...(((((.((.....(((((((((((((((..((.......))..)))..)))))))))))))).)))))........(....)..... ( -15.50, z-score = -0.55, R) >droAna3.scaffold_12913 333050 76 - 441482 ----AUCUCAUAUUUGAGG-AUGCCGUUUAAUUAAAUUUCGAUUUAUGAAAAAUACUAAGCAAAAUAUUGUGCACCAGAAG--------- ----.(((((....)))))-.(((............(((((.....)))))........((((....))))))).......--------- ( -7.30, z-score = 0.76, R) >droSec1.super_5 722494 71 + 5866729 AGAAAAUCUAUACGAAAGAUAUAGGGUAGGGUUUGAAUUAAAUAUUCCUUAUGUCCUGUGUAUGCUAUUUU------------------- ........((((((...(((((((((....(((((...)))))...)))))))))...)))))).......------------------- ( -15.10, z-score = -1.73, R) >droSim1.chr2L 2511119 90 + 22036055 AGAAAAUCUAUACGAAAGAUAUAGGGUAGGGUUUGAAUUAAAUAUUCCUUAUAUCCUGUGUAUGCUAAUUUAAAACCAGGGAAACAAAAA ........((((((...(((((((((....(((((...)))))...)))))))))...))))))...............(....)..... ( -16.60, z-score = -0.95, R) >consensus AGAAAAUCUAUACGAAAGAUAUAGGGUAGGGUUUGAAUUAAAUAUUCCUUAUAUCCUGUGUAUGCUAAUUUAAAACCAGGG_________ ..................(((((((((((((..((.......))..)))..))))))))))............................. ( -7.82 = -6.45 + -1.37)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:11:42 2011