| Sequence ID | dm3.chr2R |
|---|---|
| Location | 7,150,960 – 7,151,011 |
| Length | 51 |
| Max. P | 0.859086 |
| Location | 7,150,960 – 7,151,011 |
|---|---|
| Length | 51 |
| Sequences | 7 |
| Columns | 52 |
| Reading direction | forward |
| Mean pairwise identity | 74.14 |
| Shannon entropy | 0.50908 |
| G+C content | 0.36194 |
| Mean single sequence MFE | -9.31 |
| Consensus MFE | -6.89 |
| Energy contribution | -6.97 |
| Covariance contribution | 0.08 |
| Combinations/Pair | 1.50 |
| Mean z-score | -0.89 |
| Structure conservation index | 0.74 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.95 |
| SVM RNA-class probability | 0.859086 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 7150960 51 + 21146708 AAUCAAUCAGGCAGCGAUUGGCCAAUAUGGGCCAAA-AAACAUUUUAUAAUU .................((((((......)))))).-............... ( -9.60, z-score = -1.01, R) >droWil1.scaffold_180697 3560681 52 + 4168966 UAAAAGCCUUUAAGCUGUUUUCCAUAAUUGGUUGGACAAAGAAAAAAUAAUC ....(((......)))((((.(((....)))..))))............... ( -6.20, z-score = -0.26, R) >droSim1.chr2R 5702196 50 + 19596830 AAUCAAUCAGGCAGCGGUUGGCCAAUAUGGGCCAAA-ACACAUUU-AUAAUU .................((((((......)))))).-........-...... ( -9.50, z-score = -0.81, R) >droSec1.super_1 4719511 50 + 14215200 AAUCAAUCAGGCAGCGGUUGGCCAAUAUGGGCCAAA-ACACAUUU-AUAAUU .................((((((......)))))).-........-...... ( -9.50, z-score = -0.81, R) >droYak2.chr2R 19150311 50 - 21139217 AAUCAAUCAGGCAACUGUUGGCCAAUAUGGGCUAAA-ACAUAUUU-AUAAUU .......(((....)))((((((......)))))).-........-...... ( -11.40, z-score = -2.40, R) >droEre2.scaffold_4845 3946988 50 - 22589142 AAUCAAUCAGGCAGCGAUUGGCCAAUAUGGGCCAAA-ACAUGUUU-AUAAUU ........(((((....((((((......)))))).-...)))))-...... ( -12.60, z-score = -1.85, R) >droAna3.scaffold_13266 859838 51 + 19884421 AAUCAAUCUUGCCACUCUUGGCCAAUGUGGGGCAAA-CAGAAAAGUAUAAUU ........(((((.(....).((.....))))))).-............... ( -6.40, z-score = 0.94, R) >consensus AAUCAAUCAGGCAGCGGUUGGCCAAUAUGGGCCAAA_ACACAUUU_AUAAUU .................((((((......))))))................. ( -6.89 = -6.97 + 0.08)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:14:56 2011