| Sequence ID | dm3.chr2R |
|---|---|
| Location | 7,133,453 – 7,133,510 |
| Length | 57 |
| Max. P | 0.980079 |
| Location | 7,133,453 – 7,133,510 |
|---|---|
| Length | 57 |
| Sequences | 7 |
| Columns | 60 |
| Reading direction | forward |
| Mean pairwise identity | 69.71 |
| Shannon entropy | 0.57611 |
| G+C content | 0.30592 |
| Mean single sequence MFE | -11.50 |
| Consensus MFE | -5.51 |
| Energy contribution | -5.13 |
| Covariance contribution | -0.38 |
| Combinations/Pair | 1.64 |
| Mean z-score | -2.01 |
| Structure conservation index | 0.48 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.04 |
| SVM RNA-class probability | 0.980079 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 7133453 57 + 21146708 UCAA-UUGUUUACGU-GCUGCCGUUUUAUAAUAUCAAAUAAAUCUG-UGCAACGUAAACA ....-.(((((((((-((.((.(.(((((........))))).).)-))).))))))))) ( -13.40, z-score = -3.24, R) >droSim1.chr2R 5680837 57 + 19596830 UCAA-UUGUUUACGU-GCUGGCGUUUUAUGUUAUCAAAUACUUUUG-UGCAAAGUAAACA ....-.(((((((.(-((((((((...)))))).((((....))))-.)))..))))))) ( -9.80, z-score = -0.50, R) >droSec1.super_1 4701940 57 + 14215200 UCAA-UUGUUUACGU-GCUGGCGUUUUAUGUUAUCAAAUAAAUUUG-UGCAAAGUAAACA ....-.(((((((.(-((..(((.(((((........)))))..))-))))..))))))) ( -10.20, z-score = -0.71, R) >droYak2.chr2R 19128091 57 - 21139217 UCAA-UUGUUUACGU-UCUGGCAUUUUAUGGUAUCGAAUAAAUCUG-UGAAACGUAAACA ....-.(((((((((-(.(.(((.(((((........)))))..))-).))))))))))) ( -13.70, z-score = -2.88, R) >droEre2.scaffold_4845 3926696 57 - 22589142 UAAA-UUGUUUGCGC-UGCGACAUUUUAUGGUAUCAAAUAAAUUUG-UCAAACGUAAACA ....-.((((((((.-(..((((.(((((........)))))..))-)).).)))))))) ( -13.20, z-score = -2.09, R) >droAna3.scaffold_13266 844940 58 + 19884421 UAAGCUUGUUUACUC-UUUGACAUUUUAUGGGAAACAUUAAAUUCC-UUUUCUAUAAACA ......((((.....-...)))).(((((((((((...........-))))))))))).. ( -6.80, z-score = -1.23, R) >droPer1.super_4 6344383 59 + 7162766 UCAU-UUGUUUGUGCCGUCAGGAUUUUAAUGAAAACAUUAACUUCCAUCUACCACAAAUG ....-..(((((((......(((..((((((....))))))..)))......))))))). ( -13.40, z-score = -3.39, R) >consensus UCAA_UUGUUUACGU_GCUGGCAUUUUAUGGUAUCAAAUAAAUUUG_UGCAACGUAAACA ......(((((((...((......(((((........)))))......))...))))))) ( -5.51 = -5.13 + -0.38)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:14:54 2011