| Sequence ID | dm3.chr2R |
|---|---|
| Location | 6,983,903 – 6,983,953 |
| Length | 50 |
| Max. P | 0.882532 |
| Location | 6,983,903 – 6,983,953 |
|---|---|
| Length | 50 |
| Sequences | 7 |
| Columns | 53 |
| Reading direction | reverse |
| Mean pairwise identity | 70.27 |
| Shannon entropy | 0.59378 |
| G+C content | 0.34857 |
| Mean single sequence MFE | -6.89 |
| Consensus MFE | -3.70 |
| Energy contribution | -3.60 |
| Covariance contribution | -0.10 |
| Combinations/Pair | 1.56 |
| Mean z-score | -1.15 |
| Structure conservation index | 0.54 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.05 |
| SVM RNA-class probability | 0.882532 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 6983903 50 - 21146708 --CACCAUUCCGCAUCUGCAUAUGUAU-UAUUUAUGAAUUUACAUACGCAUCU --..............(((.((((((.-............)))))).)))... ( -6.92, z-score = -1.67, R) >droSim1.chr2R 5524712 50 - 19596830 --CACCAUUCCGCAUCUGCAUAUGUAU-UAUUUAUGAAUUUACAUACGCAUCU --..............(((.((((((.-............)))))).)))... ( -6.92, z-score = -1.67, R) >droSec1.super_1 4550909 50 - 14215200 --CACCAUUCCGCAUCUGCAUAUGUAU-UAUUUAUGAAUUUACAUACGCAUCU --..............(((.((((((.-............)))))).)))... ( -6.92, z-score = -1.67, R) >droYak2.chr2R 18980004 50 + 21139217 --CACCAAUCCGCAUCUGCAUAUGUAU-UAUUUAUGAAUUUACAUACGCAUCU --..............(((.((((((.-............)))))).)))... ( -6.92, z-score = -1.61, R) >droEre2.scaffold_4845 3775683 50 + 22589142 --CACCAAUCCGCAUCUGCAUAUGUAU-UAUUUAUGAAUUUACAUGCGCAUCU --..............(((.((((((.-............)))))).)))... ( -6.62, z-score = -0.55, R) >droWil1.scaffold_180697 3314202 50 - 4168966 CUGUUGUAGCUCAAUUUGUCGUUGUUCUUGU---UGUUUUUACAGUGGCACAA (..((((((..((((..(........)..))---))...))))))..)..... ( -8.00, z-score = -0.45, R) >droMoj3.scaffold_6496 26790166 50 + 26866924 ---CCAAAGCUACAUUUGUAUCUUUAUCUGUGUGCAAGAAAACAUCUGUAUCU ---.....((.((((..(((....)))..)))))).................. ( -5.90, z-score = -0.45, R) >consensus __CACCAAUCCGCAUCUGCAUAUGUAU_UAUUUAUGAAUUUACAUACGCAUCU ................(((.((((((..............)))))).)))... ( -3.70 = -3.60 + -0.10)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:14:31 2011