| Sequence ID | dm3.chr2R |
|---|---|
| Location | 6,425,216 – 6,425,266 |
| Length | 50 |
| Max. P | 0.924768 |
| Location | 6,425,216 – 6,425,266 |
|---|---|
| Length | 50 |
| Sequences | 6 |
| Columns | 62 |
| Reading direction | forward |
| Mean pairwise identity | 69.57 |
| Shannon entropy | 0.50996 |
| G+C content | 0.55085 |
| Mean single sequence MFE | -16.35 |
| Consensus MFE | -9.37 |
| Energy contribution | -10.03 |
| Covariance contribution | 0.67 |
| Combinations/Pair | 1.00 |
| Mean z-score | -1.58 |
| Structure conservation index | 0.57 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.31 |
| SVM RNA-class probability | 0.924768 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 6425216 50 + 21146708 -------CCGGCCUUUUUUGGGGUUGCAAUCAACCCCUAAA-CUAAG-CCGAUCCCCCC--- -------.((((.(..((((((((((....))))))).)))-..).)-)))........--- ( -17.90, z-score = -3.34, R) >droSim1.chr2R 5056626 51 + 19596830 -------CCCGGGUUUUUUGGGGUUGCAAUCAACCCCUAAAACUAAG-CCGAUCCCCCC--- -------..((((((((..(((((((....))))))).)))))....-)))........--- ( -16.40, z-score = -1.66, R) >droSec1.super_1 4036533 51 + 14215200 -------CCCGGGUUUUUUGGGGUUGCAAUCAACCCCUAAAACUAAG-CCGAUCCCCCC--- -------..((((((((..(((((((....))))))).)))))....-)))........--- ( -16.40, z-score = -1.66, R) >droYak2.chr2R 18423652 50 - 21139217 -------UCCGGGUUUUUUGGGGUUGCAAUCAACCCCUAAA-CUAAG-CCGAUCCCCCC--- -------..(((.((.((((((((((....))))))).)))-..)).-)))........--- ( -16.30, z-score = -1.73, R) >droVir3.scaffold_12875 16411501 51 + 20611582 -------GUACAUUUUUUGGGGGUUGCA----ACCCCUAAAAGUGCGGCCGGAGAUCCCCCC -------((((...((((((((((....----))))))))))))))((..((....))..)) ( -18.40, z-score = -1.36, R) >droMoj3.scaffold_6496 19516209 52 - 26866924 GUAAACUUUUUUCCUGUUGGGGGUUGCA----ACCCCUAAAUGUGCG-CCGGCCACC----- ................((((((((....----))))))))..(((.(-....)))).----- ( -12.70, z-score = 0.27, R) >consensus _______CCCGGGUUUUUUGGGGUUGCAAUCAACCCCUAAAACUAAG_CCGAUCCCCCC___ ...................(((((((....)))))))......................... ( -9.37 = -10.03 + 0.67)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:12:35 2011