| Sequence ID | dm3.chr2R |
|---|---|
| Location | 6,243,701 – 6,243,791 |
| Length | 90 |
| Max. P | 0.801057 |
| Location | 6,243,701 – 6,243,791 |
|---|---|
| Length | 90 |
| Sequences | 5 |
| Columns | 94 |
| Reading direction | forward |
| Mean pairwise identity | 71.87 |
| Shannon entropy | 0.45856 |
| G+C content | 0.29760 |
| Mean single sequence MFE | -13.21 |
| Consensus MFE | -9.47 |
| Energy contribution | -8.87 |
| Covariance contribution | -0.60 |
| Combinations/Pair | 1.36 |
| Mean z-score | -1.06 |
| Structure conservation index | 0.72 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.73 |
| SVM RNA-class probability | 0.801057 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 6243701 90 + 21146708 UAAUUAUUUAAAUGCAAAAUCGUUAACAUCUGCUUCAGAGCAUGUGAUAAUAAAACCAUAUAAACAUAGCUCUUUCGGAAGCGUUAUCAG---- .....................(.((((....((((((((((((((..................)))).)))))....))))))))).)..---- ( -14.47, z-score = -1.22, R) >droSim1.chr2R 4866634 90 + 19596830 UAUUUAUUUAAAUGCAAAAUCGUUAACAUCUGCUUCAGAGCAUGUGAUAAUAAAACCAUGUAAACAUAGCUCUUUCGGAAGCGUUAUCAG---- .....................(.((((....((((((((((((((....((......))....)))).)))))....))))))))).)..---- ( -14.70, z-score = -0.87, R) >droSec1.super_1 3850863 90 + 14215200 UAUUUAUUUAAAUGCAAAAUCGUUAACAUCUCCUUCAGAGCAUGUAAUAAUAAAAUCAUAUAAACAUAGCUCUUUCGGAAGCGUUAUCAG---- ..........(((((......(....)...(((...(((((((((..................)))).)))))...))).))))).....---- ( -13.67, z-score = -2.07, R) >droYak2.chr2L 18869933 76 + 22324452 ----------------UAUUUAUU--UAAAUGCUUUGGAGCAAAUCUUAAUAAAACCAUAUAAACAGGGCUCUUUUGGAAGCAUUAUCAGAGAA ----------------........--..(((((((((((((........(((......))).......)))))....))))))))......... ( -11.96, z-score = -0.55, R) >droEre2.scaffold_4929 18513082 76 - 26641161 ----------------UAUUUAUU--UAAUUGCUUUAGAGCAAGUCUUAAUAAAACCAUAUAAACAGAGCUCUUUCAAAAGCAUUUUCAGAGCA ----------------..((((((--...(((((....))))).....))))))..............(((((...............))))). ( -11.26, z-score = -0.60, R) >consensus UA_UUAUUUAAAUGCAAAAUCGUUAACAUCUGCUUCAGAGCAUGUCAUAAUAAAACCAUAUAAACAUAGCUCUUUCGGAAGCGUUAUCAG____ ..............................(((((((((((...........................)))))....))))))........... ( -9.47 = -8.87 + -0.60)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:12:14 2011