| Sequence ID | dm3.chr2L |
|---|---|
| Location | 2,415,375 – 2,415,441 |
| Length | 66 |
| Max. P | 0.846657 |
| Location | 2,415,375 – 2,415,441 |
|---|---|
| Length | 66 |
| Sequences | 8 |
| Columns | 69 |
| Reading direction | reverse |
| Mean pairwise identity | 60.09 |
| Shannon entropy | 0.82042 |
| G+C content | 0.44732 |
| Mean single sequence MFE | -13.76 |
| Consensus MFE | -3.86 |
| Energy contribution | -3.75 |
| Covariance contribution | -0.11 |
| Combinations/Pair | 1.14 |
| Mean z-score | -1.64 |
| Structure conservation index | 0.28 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.90 |
| SVM RNA-class probability | 0.846657 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 2415375 66 - 23011544 AAAAUACCAAAACAACGUCGAAAGCUUUUCACGCAA---AGCGAGCUUUUGCGCACCAGUACCAGUACG ...............((.((((((((.....(((..---.))))))))))))).....(((....))). ( -11.90, z-score = -0.99, R) >droSim1.chr2L 2374128 56 - 22036055 AAAAUACCAAA---------AAAGCUUUUCACGC-A---ACCGAGCUUUUUCUCACCAGUGCCAGUCCG .........((---------(((((((.......-.---...))))))))).................. ( -5.90, z-score = -0.82, R) >droSec1.super_5 588695 56 - 5866729 AAAAUACCAAA---------AAAGCUUUUCACGC-A---ACCGAGCUUUUGCUCGCCAGUGCCAGUACG ...........---------...(((...(((..-.---..(((((....)))))...)))..)))... ( -10.90, z-score = -1.47, R) >droYak2.chr2L 2401996 63 - 22324452 UAAAUACCAAAACAAAGUCGAAAGCUUUUCACGCAAAGCAGCGAGCUUUUGCGCACCAGCGCG------ ...................(((((((.....(((......))))))))))((((....)))).------ ( -15.40, z-score = -1.46, R) >droEre2.scaffold_4929 2457324 60 - 26641161 UAAAUACCAAAACGAAGUUGAAAGCUUUUCGCGUAA---AGCGAGCUUUUGCGCGCCGACGCA------ .............(((((.....)))))..((((..---.(((.((....)).)))..)))).------ ( -15.50, z-score = -0.41, R) >droAna3.scaffold_12916 9582683 59 - 16180835 AAAAUACCAAAACAAA-UCCAAAGCUUUCCAUCAAG---AGUGAGCUUUCGUUUGCCGGUGCA------ ....((((....((((-(..(((((((.(.......---.).))))))).)))))..))))..------ ( -10.10, z-score = -0.94, R) >droVir3.scaffold_12963 9759164 65 - 20206255 -AAAAAUUAAACCAUAGG--AAAGCUUUUUCAGCAACAGAGCGAGCUUUUGCUACGCUCUGCUCCACA- -...............((--(..(((.....)))..((((((((((....))).))))))).)))...- ( -21.20, z-score = -3.93, R) >droGri2.scaffold_15252 5143938 58 + 17193109 -------GAAAGCACCAU--AGAGCUUUCAC-UUGACAGAGCGAGCUUUUUUGGUUCGCUGCUAUACA- -------((((((.....--...))))))..-.....((((((((((.....)))))))).)).....- ( -19.20, z-score = -3.14, R) >consensus AAAAUACCAAAACAAAGU__AAAGCUUUUCACGCAA___AGCGAGCUUUUGCGCACCAGUGCCA_____ ....................(((((((...............))))))).................... ( -3.86 = -3.75 + -0.11)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:11:11 2011