| Sequence ID | dm3.chr2R |
|---|---|
| Location | 5,104,699 – 5,104,763 |
| Length | 64 |
| Max. P | 0.912899 |
| Location | 5,104,699 – 5,104,763 |
|---|---|
| Length | 64 |
| Sequences | 6 |
| Columns | 73 |
| Reading direction | forward |
| Mean pairwise identity | 50.26 |
| Shannon entropy | 0.81175 |
| G+C content | 0.40262 |
| Mean single sequence MFE | -15.93 |
| Consensus MFE | -5.43 |
| Energy contribution | -4.32 |
| Covariance contribution | -1.11 |
| Combinations/Pair | 2.08 |
| Mean z-score | -1.45 |
| Structure conservation index | 0.34 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.23 |
| SVM RNA-class probability | 0.912899 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 5104699 64 + 21146708 AAAUGCAUGCAUAUGCAUUUGCUCAGUUGCA-ACUGAAAAUGAAAAGGGGCAAAUGCAUCUGCGU-------- ......(((((.((((((((((((..((.((-........)).))..)))))))))))).)))))-------- ( -23.90, z-score = -3.62, R) >droYak2.chr2L 17759453 57 + 22324452 AAAUGCAUGCAUAUGCAUUUGCUCAGUUGCA-ACUGAAAA-------AGGAAAAUGCAACUGCGU-------- ((((((((....))))))))((.((((((((-.((.....-------)).....)))))))).))-------- ( -17.80, z-score = -2.47, R) >droEre2.scaffold_4929 9088294 56 - 26641161 AAAUGCAUGCAUAUGCAUUGGCUCAGUUGCA-ACUGAAAA--------GGGAAAUGCAGCUGCGU-------- .(((((((....))))))).((.((((((((-.((....)--------).....)))))))).))-------- ( -18.90, z-score = -1.96, R) >droAna3.scaffold_13266 11415020 55 - 19884421 AAAUAGAUGU---UAUUUUGGUUUUUGCUUGAAUUGAAAAC-------UGCACACGUACAUGCAU-------- ..........---..(((..((((......))))..)))..-------((((........)))).-------- ( -6.60, z-score = 0.58, R) >dp4.chr3 9171137 56 + 19779522 GAAUUUGUACGUCAGAGUGCGGUUAGCCAUUCGUUGAUGAU-------UUGCAAUGUGGCAAA---------- ....((((((......))))))...((((..(((((.....-------...)))))))))...---------- ( -13.60, z-score = -0.77, R) >droPer1.super_4 4494678 66 + 7162766 GAAUUUGUACGUCAGAGUGCGGUUAGCCAUUCGUUGAUGAU-------UUGCAAUGUGGCAAAGCAAGAGAGA ...(((((.(((((((((((.....).)))))..))))).(-------((((......))))))))))..... ( -14.80, z-score = -0.49, R) >consensus AAAUGCAUGCAUAUGCAUUCGCUCAGUCGCA_ACUGAAAAU_______GGGAAAUGCAGCUGCGU________ ((((((........)))))).....((((((.......................))))))............. ( -5.43 = -4.32 + -1.11)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:09:47 2011