| Sequence ID | dm3.chr2R |
|---|---|
| Location | 4,975,384 – 4,975,439 |
| Length | 55 |
| Max. P | 0.999715 |
| Location | 4,975,384 – 4,975,439 |
|---|---|
| Length | 55 |
| Sequences | 7 |
| Columns | 66 |
| Reading direction | forward |
| Mean pairwise identity | 73.71 |
| Shannon entropy | 0.47207 |
| G+C content | 0.34062 |
| Mean single sequence MFE | -14.73 |
| Consensus MFE | -10.68 |
| Energy contribution | -11.06 |
| Covariance contribution | 0.37 |
| Combinations/Pair | 1.31 |
| Mean z-score | -3.69 |
| Structure conservation index | 0.73 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 4.24 |
| SVM RNA-class probability | 0.999715 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 4975384 55 + 21146708 UUUUUAUUUCGUUGUAUUUUUAUUU-----------ACCGAAAUGCAACGAAAGGAGGCCAAUCCC ......((((((((((((((.....-----------...))))))))))))))(((......))). ( -17.00, z-score = -4.58, R) >droVir3.scaffold_12875 20236611 51 - 20611582 ---UGUGGCUGUUGCGUUUGACAU------------AUAAACAUGCAGCGAAAGGAGCCAAAUCCU ---....(((((...(((((....------------.)))))..)))))...((((......)))) ( -12.00, z-score = -0.72, R) >droWil1.scaffold_181141 3765485 66 + 5303230 UUUUGGUUUUGUUGUGUUUUGAUUCUUUGCCUUUGGAUAUUAAUGGAACGAAAAGAGCCCAAUUCU ..(((((((((((.((((...((((.........))))...)))).))))))).....)))).... ( -10.00, z-score = -0.01, R) >droEre2.scaffold_4929 8967119 55 - 26641161 UUUUAAUUUCGUUGUAUUUUUAUUU-----------ACCUAAAUGCAACGAAAGGAGACCAAUCCU ......(((((((((((((......-----------....)))))))))))))(((......))). ( -15.90, z-score = -5.47, R) >droYak2.chr2L 17637163 55 + 22324452 UUCGUAAUUCGUUGUAUUUUUAUUU-----------ACCAAAAUGCAACGAAAGGAGGCCAAUCCU .......(((((((((((((.....-----------...)))))))))))))((((......)))) ( -16.60, z-score = -4.45, R) >droSec1.super_1 2613489 55 + 14215200 UUUUUAUUUCGUUGUAUUUUUAUUU-----------ACCAAAAUGCAACGAAAGGAAGCCAAUCCC ......((((((((((((((.....-----------...))))))))))))))(((......))). ( -15.80, z-score = -5.31, R) >droSim1.chr2R 3645472 55 + 19596830 UUUUUAUUUCGUUGUAUUUUUAUUU-----------ACCAAAAUGCAACGAAAGGAAGCCAAUCCC ......((((((((((((((.....-----------...))))))))))))))(((......))). ( -15.80, z-score = -5.31, R) >consensus UUUUUAUUUCGUUGUAUUUUUAUUU___________ACCAAAAUGCAACGAAAGGAGGCCAAUCCU ......(((((((((((((.....................)))))))))))))(((......))). (-10.68 = -11.06 + 0.37)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:09:36 2011