| Sequence ID | dm3.chr2R |
|---|---|
| Location | 3,606,586 – 3,606,677 |
| Length | 91 |
| Max. P | 0.788224 |
| Location | 3,606,586 – 3,606,677 |
|---|---|
| Length | 91 |
| Sequences | 8 |
| Columns | 91 |
| Reading direction | forward |
| Mean pairwise identity | 96.86 |
| Shannon entropy | 0.05967 |
| G+C content | 0.26511 |
| Mean single sequence MFE | -9.45 |
| Consensus MFE | -9.64 |
| Energy contribution | -9.45 |
| Covariance contribution | -0.19 |
| Combinations/Pair | 1.07 |
| Mean z-score | -0.95 |
| Structure conservation index | 1.02 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.69 |
| SVM RNA-class probability | 0.788224 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 3606586 91 + 21146708 CAAUCGAUAAACGACAACAUCGAAAGUUAUGCGCAAGUAAACAAAUAUUACUUAUCACGAAAAUAAAAUACGUUCUAUAAAAUCUAUAAAA .....(((((.(((.....)))...(((.(((....)))))).........)))))................................... ( -9.60, z-score = -1.01, R) >droPer1.super_2 6200109 91 - 9036312 CAAUCGGUAAACGACAACAUCGAUAGUUAUGCGCAAGUAAACAAUUAUUACUUAUCAAGAAAACAAAAUACGUUCUAUAAAAUCUAUAAAA .....(((((.(((.....)))...(((.(((....)))))).........)))))................................... ( -9.00, z-score = -0.58, R) >dp4.chr3 17129675 91 - 19779522 CAAUCGGUAAACGACAACAUCGAUAGUUAUGCGCAAGUAAACAAUUAUUACUUAUCAAGAAAACAAAAUACGUUCUAUAAAAUCUAUAAAA .....(((((.(((.....)))...(((.(((....)))))).........)))))................................... ( -9.00, z-score = -0.58, R) >droAna3.scaffold_13266 10115075 91 + 19884421 CAAUCGAUAAACGACAACAUCGAAAGUUAUGCGCAAGUAAACAAAUAUUACUUAUCAAGAAAACAAAAUACGUUCUAUAAAAUCUAUAAAA .....(((((.(((.....)))...(((.(((....)))))).........)))))................................... ( -9.60, z-score = -1.44, R) >droEre2.scaffold_4929 7640028 91 - 26641161 CAAUCGAUAAACGACAACAUCGAAAGUUAUGCGCAAGUAAACAAAUUUUACUUAUCACGAAAAUAAAAUACGUUCUAUAAAAUCUAUAAAA .....(((((.(((.....)))...(((.(((....)))))).........)))))................................... ( -9.60, z-score = -0.86, R) >droYak2.chr2L 16279234 91 + 22324452 CAAUCGAUAAACGACAACAUCGAAAGUUAUGCGCAAGUAAACAAAUAUUACUUAUCACGAAAAUAAAAUAUGUUCUAUAAAAUCUAUAAAA .....(((((.(((.....)))...(((.(((....)))))).........)))))................................... ( -9.60, z-score = -1.08, R) >droSec1.super_1 1262081 91 + 14215200 CAAUCGAUAAACGACAACAUCGAAAGUUAUGCGCAAGUAAACAAAUAUUACUUAUCACGAAAAUAAAAUACGUUCUAUAAAAUCUAUAAAA .....(((((.(((.....)))...(((.(((....)))))).........)))))................................... ( -9.60, z-score = -1.01, R) >droSim1.chr2R 2330633 91 + 19596830 CAAUCGAUAAACGACAACAUCGAAAGUUAUGCGCAAGUAAACAAAUAUUACUUAUCACGAAAAUAAAAUACGUUCUAUAAAAUCUAUAAAA .....(((((.(((.....)))...(((.(((....)))))).........)))))................................... ( -9.60, z-score = -1.01, R) >consensus CAAUCGAUAAACGACAACAUCGAAAGUUAUGCGCAAGUAAACAAAUAUUACUUAUCACGAAAAUAAAAUACGUUCUAUAAAAUCUAUAAAA .....(((((.(((.....)))...(((.(((....)))))).........)))))................................... ( -9.64 = -9.45 + -0.19)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:06:14 2011