| Sequence ID | dm3.chr2R |
|---|---|
| Location | 3,106,921 – 3,107,011 |
| Length | 90 |
| Max. P | 0.811793 |
| Location | 3,106,921 – 3,107,011 |
|---|---|
| Length | 90 |
| Sequences | 6 |
| Columns | 100 |
| Reading direction | reverse |
| Mean pairwise identity | 66.94 |
| Shannon entropy | 0.59939 |
| G+C content | 0.43160 |
| Mean single sequence MFE | -20.27 |
| Consensus MFE | -13.36 |
| Energy contribution | -13.42 |
| Covariance contribution | 0.06 |
| Combinations/Pair | 1.32 |
| Mean z-score | -0.57 |
| Structure conservation index | 0.66 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.77 |
| SVM RNA-class probability | 0.811793 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 3106921 90 - 21146708 UUGUUUCCCCGAUUAAUUAAAGGUUACAAAACGGGAAAUGGUCGGGAGGGACAUACACAUAUGU--ACAUACAUCAG--------UGGAUAGGAAAGGAG .(((..(((((((((.((....(((....)))...)).)))))))).)..)))..(((..((((--....))))..)--------))............. ( -20.90, z-score = -1.64, R) >droSim1.chr2R 1892205 100 - 19596830 UUGUUACCCCGAUUAAUUAAAGGUUACAAAACGGGAAAUGGUCGGGAGGGACAUACCCAUACAUACAUGUAUAUAUGUACAUCUGUGGAUAGGAAAGGAG .(((..(((((((((.((....(((....)))...)).)))))))).)..)))..((.((.((((.((((((....)))))).)))).)).))....... ( -23.80, z-score = -0.71, R) >droSec1.super_1 763175 100 - 14215200 UUGUUUCCCCGAUCAAUUAAAGGUUACAAAACGGGAAAUGGUCGAGAGGGACAUACACAUACAUACAUAUAUAUGUGUACAUCUGUGGAUAGGAACGGAG .(((..((.((((((.((....(((....)))...)).)))))).).)..)))((((((((.((....)).))))))))..(((((........))))). ( -23.40, z-score = -1.18, R) >droYak2.chr2L 15803470 96 - 22324452 UUGUUUCCCCGAUUAAUUAAAGGUUACAAAACGGGAAAUGGUCGGGAGGGACAUACACAUGCAU-UGCACACAUCUGUGGAU---UGGAAAGGAGAGGAG .(((..(((((((((.((....(((....)))...)).)))))))).)..)))......(.((.-(.((((....)))).).---)).)........... ( -21.30, z-score = -0.43, R) >droEre2.scaffold_4929 7165960 72 + 26641161 UUGUUUCCCCGAUUAAUUAAAGGUUACCAAACGGGAAAUGGUCGGGAGGGAUACUUCUGUGGACAGGCAGGG---------------------------- .(((..(((((((((.((....(((....)))...)).)))))))).)..)))..(((((......))))).---------------------------- ( -18.40, z-score = -0.07, R) >droAna3.scaffold_13266 3331382 72 - 19884421 UUGUUUUCCCGAUUAAUUAAAGGUUACAAAAAGUGGAAUGGUCGGGGGAUGGAGUGACUGAGACCCGGAUAG---------------------------- ....(..((((((((.((...(.((.....)).).)).))))))))..)(((.((.......))))).....---------------------------- ( -13.80, z-score = 0.63, R) >consensus UUGUUUCCCCGAUUAAUUAAAGGUUACAAAACGGGAAAUGGUCGGGAGGGACAUACACAUACAUACACAUACAU_UG________UGGAUAGGAAAGGAG .((((((((((((((.((....(((....)))...)).)))))))).))))))............................................... (-13.36 = -13.42 + 0.06)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:05:09 2011