| Sequence ID | dm3.chr2R |
|---|---|
| Location | 3,043,785 – 3,043,837 |
| Length | 52 |
| Max. P | 0.597219 |
| Location | 3,043,785 – 3,043,837 |
|---|---|
| Length | 52 |
| Sequences | 9 |
| Columns | 59 |
| Reading direction | reverse |
| Mean pairwise identity | 85.68 |
| Shannon entropy | 0.28363 |
| G+C content | 0.48775 |
| Mean single sequence MFE | -15.58 |
| Consensus MFE | -10.39 |
| Energy contribution | -11.29 |
| Covariance contribution | 0.90 |
| Combinations/Pair | 1.24 |
| Mean z-score | -1.79 |
| Structure conservation index | 0.67 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.22 |
| SVM RNA-class probability | 0.597219 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 3043785 52 - 21146708 UUUCCAG-CGAAUGGUUUUUGCCCGCUUC-----UGU-AAGUUGGCAAACCCGUUUUGG ...(((.-.((((((..((((((.((((.-----...-)))).)))))).))))))))) ( -16.40, z-score = -2.46, R) >droSim1.chr2R 1841912 52 - 19596830 UUUCCAG-CGAAUGGUUUUUGCCCGCUUC-----UGU-AAGUUGGCAAACCAGUUUGGG ...((((-....(((((..((((.((((.-----...-)))).)))))))))..)))). ( -16.40, z-score = -1.87, R) >droSec1.super_1 711540 52 - 14215200 UUUCCAG-CGAAUGGUUUUUGCCCGCUUC-----UGU-AAGUUGGCAAACCCGUUUGGG .......-(((((((..((((((.((((.-----...-)))).)))))).))))))).. ( -17.60, z-score = -2.28, R) >droYak2.chr2L 15752241 52 - 22324452 UUUCCAG-CGAAUGGUUUUUGCCCGCUUC-----UGU-AACUUGGCAAACCCGUUUGGG .......-(((((((..((((((.((...-----.))-.....)))))).))))))).. ( -13.00, z-score = -0.63, R) >droEre2.scaffold_4929 7115769 52 + 26641161 UUUCCAG-CGAAUGGUUUUUGCCCACUUC-----UGU-AAGUUGGCAAACCUGUUUGGG .......-(((((((..((((((.((((.-----...-)))).)))))).))))))).. ( -14.40, z-score = -1.32, R) >droAna3.scaffold_13266 3282491 51 - 19884421 UUCCCAU-AGAAUGG-AUUUGCCCGCUUC-----UGU-AAGUUGGCAAACCCGUUUUGG ......(-(((((((-.((((((.((((.-----...-)))).)))))).)))))))). ( -18.80, z-score = -4.02, R) >dp4.chr3 1333308 52 - 19779522 UUUCCAG-CGAUUGCUGUUCGCCUGCUUC-----UGU-AAGUUGGCAAACCCGUUUGGG ....(((-(....))))...(((.((((.-----...-)))).)))...(((....))) ( -14.10, z-score = -1.06, R) >droPer1.super_2 1507602 52 - 9036312 UUUCCAG-CGAUUGCUGUUCGCCUGCUUC-----UGU-AAGUUGGCAAACCCGUUUGGG ....(((-(....))))...(((.((((.-----...-)))).)))...(((....))) ( -14.10, z-score = -1.06, R) >droGri2.scaffold_15245 9299260 59 - 18325388 UCUCAAGUUGAAUGGUUUUUGCCCGCAACGCAAACGUAAAGCUGGCAAACCCGUUUUUG .........((((((..((((((.((.(((....)))...)).)))))).))))))... ( -15.40, z-score = -1.44, R) >consensus UUUCCAG_CGAAUGGUUUUUGCCCGCUUC_____UGU_AAGUUGGCAAACCCGUUUGGG ........(((((((..((((((.((((..........)))).)))))).))))))).. (-10.39 = -11.29 + 0.90)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:05:05 2011