| Sequence ID | dm3.chr2R |
|---|---|
| Location | 2,872,232 – 2,872,299 |
| Length | 67 |
| Max. P | 0.866124 |
| Location | 2,872,232 – 2,872,299 |
|---|---|
| Length | 67 |
| Sequences | 7 |
| Columns | 67 |
| Reading direction | reverse |
| Mean pairwise identity | 78.11 |
| Shannon entropy | 0.40006 |
| G+C content | 0.50452 |
| Mean single sequence MFE | -14.98 |
| Consensus MFE | -10.53 |
| Energy contribution | -9.86 |
| Covariance contribution | -0.67 |
| Combinations/Pair | 1.43 |
| Mean z-score | -1.53 |
| Structure conservation index | 0.70 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.98 |
| SVM RNA-class probability | 0.866124 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 2872232 67 - 21146708 GUCGCAACACUCCCCGCAGUCCUCACAAUUCGUUUUAUCCCCACGGGGGGUGAUAUAGCAAACAAAA ...((..(((((((((...........................))))))))).....))........ ( -15.43, z-score = -1.28, R) >droSec1.super_1 546175 67 - 14215200 GUCGCAACACUCCCCGCAGUCCUCACAAUUCGUUUUAUCCCCACGGGGGGUGAUAUAGCAAACAAAA ...((..(((((((((...........................))))))))).....))........ ( -15.43, z-score = -1.28, R) >droSim1.chr2R 1680887 67 - 19596830 GUCGCAACACUCCCCGCAGUCCUCACAAUUCGUUUUAUCCCCACGGGGGGUGAUAUAGCAAACAAAA ...((..(((((((((...........................))))))))).....))........ ( -15.43, z-score = -1.28, R) >droYak2.chr2L 15596095 67 - 22324452 GUCUCAACACUCCCCACAGUCCUCACAAUUCGUUUUAUCCCCAGGGGGCGUGAUAUAACAGACAAAA ((((...(((.((((.........((.....))...........)))).))).......)))).... ( -11.65, z-score = -0.58, R) >droEre2.scaffold_4929 6954784 67 + 26641161 GUCUCAACACUCCCCACAGUCCUCACAAUUCGUUUUAUCCCCACGGGGGGUGAUAUAACAAACAAAA .......((((((((...((....)).....((.........))))))))))............... ( -13.30, z-score = -1.10, R) >dp4.chr3 1157105 58 - 19779522 GUUUCAACACUC------GCCUCCCCCAUUGAAGCCACCCCCA---GGGGUGGCAUAACAAAUAACA ............------...............(((((((...---.)))))))............. ( -16.80, z-score = -2.60, R) >droPer1.super_2 1324452 58 - 9036312 GUUUCAACACUC------GCCUCCCCCAUUGAAGCCACCCCCA---GGGGUGGCAUAACAAAUAACA ............------...............(((((((...---.)))))))............. ( -16.80, z-score = -2.60, R) >consensus GUCUCAACACUCCCCGCAGUCCUCACAAUUCGUUUUAUCCCCACGGGGGGUGAUAUAACAAACAAAA ..................................(((((((.....))))))).............. (-10.53 = -9.86 + -0.67)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:04:40 2011