| Sequence ID | dm3.chr2R |
|---|---|
| Location | 622,109 – 622,159 |
| Length | 50 |
| Max. P | 0.960123 |
| Location | 622,109 – 622,159 |
|---|---|
| Length | 50 |
| Sequences | 5 |
| Columns | 51 |
| Reading direction | forward |
| Mean pairwise identity | 52.98 |
| Shannon entropy | 0.89311 |
| G+C content | 0.44000 |
| Mean single sequence MFE | -9.28 |
| Consensus MFE | -4.74 |
| Energy contribution | -4.90 |
| Covariance contribution | 0.16 |
| Combinations/Pair | 1.78 |
| Mean z-score | -0.60 |
| Structure conservation index | 0.51 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.68 |
| SVM RNA-class probability | 0.960123 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 622109 50 + 21146708 -UGGAUACUAUCCCCAAAGGUGGAAAAAAUCUGUUAUAGUAAUGAUUCCCA -.(((((((((......((((.......))))...)))))).....))).. ( -5.80, z-score = 0.89, R) >dp4.Unknown_group_56 13129 50 + 24345 -UGGGUGCUUUCUUGGAAGAUGGAAAAAGCAAAAGCUAGUGCUGAUACCAA -(((.((((((((........)))..)))))..(((....)))....))). ( -10.20, z-score = -0.43, R) >droMoj3.scaffold_6541 1256622 50 + 2543558 AGGAGACGUUCCCUGCAGCCUGGAAAACUCAGAACUUUGUAUUGCUACCA- ..(((...((((.........))))..)))....................- ( -5.30, z-score = 1.67, R) >anoGam1.chrX 2033201 50 - 22145176 -UGGCUACUUUCCUAAUGCUUGGAAAAUAGCUAAAGUUAUCGCGAUACCCA -((((((.(((((........))))).)))))).................. ( -12.40, z-score = -2.34, R) >triCas2.ChLG6 13527277 50 + 13544221 -CGGUCACUUUCCAACCCCAUGGAAAGAAGCCAGCACCAUCAUGAUCCCCA -.(((..(((((((......)))))))..)))................... ( -12.70, z-score = -2.78, R) >consensus _UGGGUACUUUCCUAAAACAUGGAAAAAACCUAACAUAGUAAUGAUACCCA ..((((..(((((........)))))..))))................... ( -4.74 = -4.90 + 0.16)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:01:19 2011