| Sequence ID | dm3.chr2L |
|---|---|
| Location | 2,088,306 – 2,088,398 |
| Length | 92 |
| Max. P | 0.828903 |
| Location | 2,088,306 – 2,088,398 |
|---|---|
| Length | 92 |
| Sequences | 3 |
| Columns | 93 |
| Reading direction | reverse |
| Mean pairwise identity | 93.53 |
| Shannon entropy | 0.08887 |
| G+C content | 0.26710 |
| Mean single sequence MFE | -18.10 |
| Consensus MFE | -15.97 |
| Energy contribution | -15.97 |
| Covariance contribution | 0.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | -1.93 |
| Structure conservation index | 0.88 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.83 |
| SVM RNA-class probability | 0.828903 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 2088306 92 - 23011544 -UGUAGAUAAAUCUAGUUUCAAGGCAAAAAUAAUAGCAUGUGCUAACUUUUUGAAUUACUUAUUCAUAACAAGUGCAGAAAUAUUUAUUUGCU -.((((((((((...(((((...((........((((....))))((((..(((((.....)))))....)))))).))))))))))))))). ( -19.50, z-score = -1.77, R) >droSim1.chr2L 2059286 93 - 22036055 UUGUAGAUAAAUCUAGUUUCAAGCCAAAAAUAAUAGCAUGUGCUAACUUUUUGAAUUACUUAUUCAUAUCAAGUGCCGAAAUAUUUAUUUGCC ..((((((((((...(((((.............((((....))))((((..(((((.....)))))....))))...))))))))))))))). ( -17.60, z-score = -2.05, R) >droSec1.super_14 2034712 92 - 2068291 -UGUAGAUAAAUAUAGUUUCAAGCUAAAAAUAAUAGCAUGUGCUAACUUUUUGAAUUACUUAUUCACAUCAAAUGCCGAAAUAUUUAUUUGCC -.(((((((((((((((..((.((((.......)))).)).))))......(((((.....)))))...............))))))))))). ( -17.20, z-score = -1.96, R) >consensus _UGUAGAUAAAUCUAGUUUCAAGCCAAAAAUAAUAGCAUGUGCUAACUUUUUGAAUUACUUAUUCAUAUCAAGUGCCGAAAUAUUUAUUUGCC ..((((((((((...(((((.............((((....))))......(((((.....)))))...........))))))))))))))). (-15.97 = -15.97 + 0.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:10:09 2011