| Sequence ID | dm3.chr2L |
|---|---|
| Location | 22,043,106 – 22,043,160 |
| Length | 54 |
| Max. P | 0.608076 |
| Location | 22,043,106 – 22,043,160 |
|---|---|
| Length | 54 |
| Sequences | 4 |
| Columns | 54 |
| Reading direction | forward |
| Mean pairwise identity | 86.11 |
| Shannon entropy | 0.22658 |
| G+C content | 0.35648 |
| Mean single sequence MFE | -9.99 |
| Consensus MFE | -8.26 |
| Energy contribution | -8.32 |
| Covariance contribution | 0.06 |
| Combinations/Pair | 1.10 |
| Mean z-score | -1.39 |
| Structure conservation index | 0.83 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.24 |
| SVM RNA-class probability | 0.608076 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 22043106 54 + 23011544 UCCGUUAAGCCAUGAAGAGUAUAAUCGAAUGGUUUGUAAACAAAAUUGGAUUGU ((((.((((((((...((......))..))))))))..........)))).... ( -10.40, z-score = -1.87, R) >droSim1.chr2L 21605838 54 + 22036055 UCCGUUAAGCCAUGAAGAGUAUAAUCGAAUGGUUUGUAAACAAAACUGGAUUGG ((((.((((((((...((......))..))))))))..........)))).... ( -9.70, z-score = -1.06, R) >droEre2.scaffold_4845 20124558 54 - 22589142 UCCGUUAAGCCAUGAAGAGUAUAAUCGAAUGGCUUGUAAACAAAACUGGAUUGG ((((.((((((((...((......))..))))))))..........)))).... ( -12.10, z-score = -2.01, R) >droAna3.scaffold_12943 2254300 54 - 5039921 UCCGUUAAGCCAUGUAAAGAAUGUUCAAAUGGUUUGAAUGCAAAAACUGAUUGU ....(((((((((...............)))))))))................. ( -7.76, z-score = -0.64, R) >consensus UCCGUUAAGCCAUGAAGAGUAUAAUCGAAUGGUUUGUAAACAAAACUGGAUUGG .....((((((((...((......))..)))))))).................. ( -8.26 = -8.32 + 0.06)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:57:33 2011