| Sequence ID | dm3.chr2L |
|---|---|
| Location | 21,894,280 – 21,894,332 |
| Length | 52 |
| Max. P | 0.970528 |
| Location | 21,894,280 – 21,894,332 |
|---|---|
| Length | 52 |
| Sequences | 6 |
| Columns | 52 |
| Reading direction | reverse |
| Mean pairwise identity | 92.56 |
| Shannon entropy | 0.14330 |
| G+C content | 0.35897 |
| Mean single sequence MFE | -9.80 |
| Consensus MFE | -10.39 |
| Energy contribution | -9.75 |
| Covariance contribution | -0.64 |
| Combinations/Pair | 1.31 |
| Mean z-score | -1.30 |
| Structure conservation index | 1.06 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.83 |
| SVM RNA-class probability | 0.970528 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 21894280 52 - 23011544 AAUGAGGGUUUUUUAUUGCAGUCCAGCUCGGAUUCAUUUGCAUCUUUAUUUG (((((((((.......((.(((((.....))))))).....))))))))).. ( -9.40, z-score = -0.99, R) >droSim1.chr2L 21466760 52 - 22036055 AAUGAGGGUUUUUUAUUGCAGUCCUGUUCGGAUUCAUUUGCAUCUUUAUUUG (((((((((.......((.(((((.....))))))).....))))))))).. ( -9.30, z-score = -1.31, R) >droSec1.super_28 502477 52 - 873875 AAUGAGGGUUUUUUAUUGCAGUCCAGUUCGGAUUCAUUUGCAUCUUUAUUUG (((((((((.......((.(((((.....))))))).....))))))))).. ( -9.40, z-score = -1.46, R) >droYak2.chr2R 20205266 52 + 21139217 AAUGAGGGUUUUUUAUUGCAGUCCAGCUUGGAUUCAUUUGCAUCUUUAUUUG (((((((((.......((.(((((.....))))))).....))))))))).. ( -9.70, z-score = -0.95, R) >droEre2.scaffold_4845 19962536 52 + 22589142 UGUGAGGGUUUUUUAUUGCAGUCCAGCUCGGAUUCAUUUGCAUCUUUAUUUG .((((((((.......((.(((((.....))))))).....))))))))... ( -9.00, z-score = -0.55, R) >droAna3.scaffold_12943 2125493 52 + 5039921 GAUGGAGGUUUUUUAUUGCACUCCAUUUCGGAGUCAUUUGCAUCUUUAUUUG (((((((((.......((.(((((.....))))))).....))))))))).. ( -12.00, z-score = -2.55, R) >consensus AAUGAGGGUUUUUUAUUGCAGUCCAGCUCGGAUUCAUUUGCAUCUUUAUUUG (((((((((.......((.(((((.....))))))).....))))))))).. (-10.39 = -9.75 + -0.64)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:57:13 2011