| Sequence ID | dm3.chr2L |
|---|---|
| Location | 21,005,059 – 21,005,117 |
| Length | 58 |
| Max. P | 0.915641 |
| Location | 21,005,059 – 21,005,117 |
|---|---|
| Length | 58 |
| Sequences | 3 |
| Columns | 58 |
| Reading direction | forward |
| Mean pairwise identity | 90.64 |
| Shannon entropy | 0.12666 |
| G+C content | 0.29801 |
| Mean single sequence MFE | -10.17 |
| Consensus MFE | -10.05 |
| Energy contribution | -10.50 |
| Covariance contribution | 0.45 |
| Combinations/Pair | 1.05 |
| Mean z-score | -1.39 |
| Structure conservation index | 0.99 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.25 |
| SVM RNA-class probability | 0.915641 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 21005059 58 + 23011544 AUAUAUUGUUUUAGCAUGAGCAUUUGCCUACAAUUUAAUAGGUAAUAAGUAUGAUUCG .((((((((((......))))..(((((((........)))))))..))))))..... ( -9.30, z-score = -0.79, R) >droSec1.super_18 932965 55 + 1342155 AUAUAUUGUUUUG---UGAGCAUUUGCCUACCAUUUAAUAGGUAGAUAGUAUGAUUCG .((((((((....---...((....))(((((........)))))))))))))..... ( -10.60, z-score = -1.69, R) >droSim1.chr2L 20612030 55 + 22036055 AUAUAUUGUUUUG---UGAGCAUUUGCCUACCAUUUAAUAGGUAGAUAGUAUGAUUCG .((((((((....---...((....))(((((........)))))))))))))..... ( -10.60, z-score = -1.69, R) >consensus AUAUAUUGUUUUG___UGAGCAUUUGCCUACCAUUUAAUAGGUAGAUAGUAUGAUUCG .((((((((((......))))(((((((((........)))))))))))))))..... (-10.05 = -10.50 + 0.45)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:55:42 2011