Sequence ID | dm3.chr2L |
---|---|
Location | 20,625,800 – 20,625,896 |
Length | 96 |
Max. P | 0.944871 |
Location | 20,625,800 – 20,625,896 |
---|---|
Length | 96 |
Sequences | 4 |
Columns | 97 |
Reading direction | forward |
Mean pairwise identity | 69.82 |
Shannon entropy | 0.48850 |
G+C content | 0.55019 |
Mean single sequence MFE | -21.65 |
Consensus MFE | -12.02 |
Energy contribution | -12.90 |
Covariance contribution | 0.88 |
Combinations/Pair | 1.18 |
Mean z-score | -1.43 |
Structure conservation index | 0.56 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 0.73 |
SVM RNA-class probability | 0.801071 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 20625800 96 + 23011544 -CGCACACAUUGGUGCCUGUGAGGCACACUCAUGUGCAUUGUCCAUGCACAGAUGCGCCAGCCCACUCACACUCACACACACACGUGCAUACCACUC -.((((....(((((..((((((((.((.((.(((((((.....))))))))))).))).......)))))..))).)).....))))......... ( -28.81, z-score = -1.13, R) >droSim1.chr2L 20188987 93 + 22036055 -CGCACACAUCGGUGCCUGUGACGCACACUCAUGUGCAUUGUCCAUGCACAGAUGCGCCCACCCUCUCUCACACACACACA---ACACACACCACUC -.((...((((.((((.((.((((((((....)))))...))))).)))).)))).)).......................---............. ( -20.90, z-score = -1.30, R) >droSec1.super_18 505877 93 + 1342155 -CGCACACAUUGGUGCCUGUGACGCACACUCAUGUGCAUUGUCCAUGCACAGAUGCGCCCACCCUCUCUCACACACACACA---ACACACACUACUC -........((((((..(((((((((...((.(((((((.....)))))))))))))...........)))))..))).))---)............ ( -20.70, z-score = -1.12, R) >droYak2.chr2R 6973813 75 + 21139217 CCACACAGAGUAGUGUCUUCAACGCACAC--ACAUGCAUUGUCCACACACUCUCACAC--GCUCGUGAACACAC-CACUC----------------- .......((((.((((...(((.(((...--...))).)))...))))))))((((..--....))))......-.....----------------- ( -16.20, z-score = -2.18, R) >consensus _CGCACACAUUGGUGCCUGUGACGCACACUCAUGUGCAUUGUCCAUGCACAGAUGCGCCCACCCUCUCACACACACACACA___ACACACACCACUC .......((((.((((.((.(((((((......))))...))))).)))).)))).......................................... (-12.02 = -12.90 + 0.88)
Location | 20,625,800 – 20,625,896 |
---|---|
Length | 96 |
Sequences | 4 |
Columns | 97 |
Reading direction | reverse |
Mean pairwise identity | 69.82 |
Shannon entropy | 0.48850 |
G+C content | 0.55019 |
Mean single sequence MFE | -35.68 |
Consensus MFE | -18.38 |
Energy contribution | -17.38 |
Covariance contribution | -1.00 |
Combinations/Pair | 1.41 |
Mean z-score | -2.03 |
Structure conservation index | 0.51 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 1.50 |
SVM RNA-class probability | 0.944871 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 20625800 96 - 23011544 GAGUGGUAUGCACGUGUGUGUGUGAGUGUGAGUGGGCUGGCGCAUCUGUGCAUGGACAAUGCACAUGAGUGUGCCUCACAGGCACCAAUGUGUGCG- .....(((((((...((((.(((((((.(....).)).(((((((((((((((.....))))))).)).))))))))))).))))...))))))).- ( -40.10, z-score = -1.10, R) >droSim1.chr2L 20188987 93 - 22036055 GAGUGGUGUGUGU---UGUGUGUGUGUGAGAGAGGGUGGGCGCAUCUGUGCAUGGACAAUGCACAUGAGUGUGCGUCACAGGCACCGAUGUGUGCG- .....(((..(((---((.((((.(((((.......((.((((.(((((((((.....))))))).)))))).))))))).)))))))))..))).- ( -36.31, z-score = -1.73, R) >droSec1.super_18 505877 93 - 1342155 GAGUAGUGUGUGU---UGUGUGUGUGUGAGAGAGGGUGGGCGCAUCUGUGCAUGGACAAUGCACAUGAGUGUGCGUCACAGGCACCAAUGUGUGCG- .....(((..(((---((.((((.(((((.......((.((((.(((((((((.....))))))).)))))).))))))).)))))))))..))).- ( -36.81, z-score = -2.00, R) >droYak2.chr2R 6973813 75 - 21139217 -----------------GAGUG-GUGUGUUCACGAGC--GUGUGAGAGUGUGUGGACAAUGCAUGU--GUGUGCGUUGAAGACACUACUCUGUGUGG -----------------(((((-(((((((((((.((--........)).)))))))(((((((..--..)))))))....)))))))))....... ( -29.50, z-score = -3.31, R) >consensus GAGUGGUGUGUGU___UGUGUGUGUGUGAGAGAGGGCGGGCGCAUCUGUGCAUGGACAAUGCACAUGAGUGUGCGUCACAGGCACCAAUGUGUGCG_ .......................................((((((.(((((((.....)))))))...)))))).......((((......)))).. (-18.38 = -17.38 + -1.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:54:57 2011