| Sequence ID | dm3.chr2L |
|---|---|
| Location | 19,308,608 – 19,308,658 |
| Length | 50 |
| Max. P | 0.984852 |
| Location | 19,308,608 – 19,308,658 |
|---|---|
| Length | 50 |
| Sequences | 4 |
| Columns | 50 |
| Reading direction | reverse |
| Mean pairwise identity | 92.00 |
| Shannon entropy | 0.12980 |
| G+C content | 0.44000 |
| Mean single sequence MFE | -16.55 |
| Consensus MFE | -13.69 |
| Energy contribution | -14.75 |
| Covariance contribution | 1.06 |
| Combinations/Pair | 1.06 |
| Mean z-score | -2.97 |
| Structure conservation index | 0.83 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.18 |
| SVM RNA-class probability | 0.984852 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 19308608 50 - 23011544 GCAAGUUCCUUUUCCUAAGUGUAUAUGCAAAUGGGGAAGGGAGAGCUAAG ((...((((((((((((..(((....)))..)))))))))))).)).... ( -19.40, z-score = -3.94, R) >droSim1.chr2L 18999798 50 - 22036055 GCAAGUUCCUUUUCCUAAGUGUAUAUGCAAAUGGGGAAGGGAGAGCCAAG ((...((((((((((((..(((....)))..)))))))))))).)).... ( -19.00, z-score = -3.50, R) >droSec1.super_7 2936886 50 - 3727775 GCAAGUUCCUUUUCCUAAGUGUAUUUGAAAAUGGGGAAGGGAGAGCCAAG ((...((((((((((((..(........)..)))))))))))).)).... ( -15.30, z-score = -2.05, R) >droYak2.chr2R 5816101 50 - 21139217 ACAAGUAGGUUUUCCUAAGUGUAUAUGCAAAUAGGGAAGGGAGAGCCAAG .......(((((((((...(.(((......))).)...)))))))))... ( -12.50, z-score = -2.40, R) >consensus GCAAGUUCCUUUUCCUAAGUGUAUAUGCAAAUGGGGAAGGGAGAGCCAAG ((...((((((((((((..(((....)))..)))))))))))).)).... (-13.69 = -14.75 + 1.06)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:51:52 2011